Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002489.1

Orthogroup ID

OG0004550

Physical Location & Seq

Genomic Coordinates Forward (+)

138796 .. 139191

Gene Structure 396 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002489.1_g000041.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 396 bp

ctgttgaaggaactcgatgtggcccacgctcgtcaaacccccgcggaggctcgggctcttgctgttaacgaggctcataatgaccttgccaatcaagtagcgagtgttcgcggccaattggatgatcgggccgctcgcatgcgggagataaggcttcggatgtcgactgtagaagcccaaatccgacatctccaagccagcctggcccaaatgaaccatgagctcagaatcgaggaagcccaactagaaactcccttggctgtttctgaagacttgaccaatcgcttggcccaatccgcagaacgggtttcgttggctgaaaatggagttcacgccgcaggccttcaagttgagatgctttttgtaaagcttgatttcgcgggccgccccctttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

131

Amino Acids

14.51

Weight (kDa)

5.72

Isoelectric Point (pI)

33.28

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004550)

Species	Orthologous Gene IDs
malus_domestica	MD12G1127500.v1.1 MD12G1127800.v1.1
pyrus_communis	pycom15g22880
rosa_chinensis	RchiOBHm_Chr3g0490741 RchiOBHm_Chr3g0490781 RchiOBHm_Chr5g0036381 RchiOBHm_Chr7g0204711
rosa_multiflora	Rmu_co8157836.1_g000001 Rmu_co8197550.1_g000002 Rmu_co8285827.1_g000001 Rmu_sc0000962.1_g000051 Rmu_sc0001049.1_g000003 Rmu_sc0002263.1_g000051 Rmu_sc0002489.1_g000041 Rmu_sc0004142.1_g000006 Rmu_sc0005425.1_g000014 Rmu_sc0037878.1_g000001
rosa_roxburghii	Rroxscaffold_2G00137800 Rroxscaffold_3G00248860 Rroxscaffold_5G00339360 Rroxscaffold_5G00378250 Rroxscaffold_6G00390190 Rroxscaffold_6G00393530 Rroxscaffold_7G00199500
rosa_samantha	Rh1BG194600 Rh3DG134500 Rh3DG149400 Rh3DG157200 Rh3DG157400 Rh4BG185400 Rh5CG399000
rosa_wichuraiana	Rw3G010890

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	134
AccI	GTMKAC	1 cut(s)	164
AccII	CGCG	3 cut(s)	44, 111, 380
AciI	CCGC	9 cut(s)	42, 44, 111, 132, 142, 297, 336, 380, 385
AcoI	YGGCCR	1 cut(s)	112
AcuI	CTGAAG	1 cut(s)	288
AfiI	CCNNNNNNNGG	2 cut(s)	46, 303
AgsI	TTSAA	2 cut(s)	7, 347
AjnI	CCWGG	1 cut(s)	201
AluBI	AGCT	2 cut(s)	223, 370
AluI	AGCT	2 cut(s)	223, 370
Alw21I	GWGCWC	1 cut(s)	225
Ama87I	CYCGRG	1 cut(s)	51
AoxI	GGCC	7 cut(s)	21, 112, 129, 204, 288, 340, 382
AspS9I	GGNCC	5 cut(s)	22, 129, 205, 289, 382
AvaI	CYCGRG	1 cut(s)	51
BanII	GRGCYC	2 cut(s)	58, 225
BbsI	GAAGAC	1 cut(s)	276
Bbv12I	GWGCWC	1 cut(s)	225
BciT130I	CCWGG	1 cut(s)	203
BfaI	CTAG	1 cut(s)	245
BfmI	CTRYAG	1 cut(s)	168
BglI	GCCNNNNNGGC	1 cut(s)	203
BisI	GCNGC	4 cut(s)	112, 132, 336, 385
BlsI	GCNGC	4 cut(s)	113, 133, 337, 386
Bme1390I	CCNGG	1 cut(s)	203
BmeT110I	CYCGRG	1 cut(s)	51
BmgT120I	GGNCC	5 cut(s)	22, 129, 205, 289, 382
BmrFI	CCNGG	1 cut(s)	203
BmsI	GCATC	1 cut(s)	345
BpiI	GAAGAC	1 cut(s)	276
BsaJI	CCNNGG	2 cut(s)	42, 255
Bsc4I	CCNNNNNNNGG	2 cut(s)	46, 303
BseBI	CCWGG	1 cut(s)	203
BseDI	CCNNGG	2 cut(s)	42, 255
BseGI	GGATG	2 cut(s)	127, 165
BseLI	CCNNNNNNNGG	2 cut(s)	46, 303
BseMII	CTCAG	1 cut(s)	238
Bsh1236I	CGCG	3 cut(s)	44, 111, 380
BshFI	GGCC	7 cut(s)	23, 114, 131, 206, 290, 342, 384
BsiHKAI	GWGCWC	1 cut(s)	225
BsiHKCI	CYCGRG	1 cut(s)	51
BslI	CCNNNNNNNGG	2 cut(s)	46, 303
BsnI	GGCC	7 cut(s)	23, 114, 131, 206, 290, 342, 384
BsoBI	CYCGRG	1 cut(s)	51
Bsp1286I	GDGCHC	2 cut(s)	58, 225
Bsp143I	GATC	1 cut(s)	124
BspACI	CCGC	9 cut(s)	42, 44, 111, 132, 142, 297, 336, 380, 385
BspANI	GGCC	7 cut(s)	23, 114, 131, 206, 290, 342, 384
BspCNI	CTCAG	1 cut(s)	237
BspFNI	CGCG	3 cut(s)	44, 111, 380
BsrBI	CCGCTC	1 cut(s)	134
BssECI	CCNNGG	2 cut(s)	42, 255
BssMI	GATC	1 cut(s)	124
BssT1I	CCWWGG	1 cut(s)	255
Bst2UI	CCWGG	1 cut(s)	203
Bst4CI	ACNGT	1 cut(s)	169
BstC8I	GCNNGC	5 cut(s)	136, 140, 199, 340, 382
BstDEI	CTNAG	1 cut(s)	224
BstDSI	CCRYGG	1 cut(s)	42
BstF5I	GGATG	2 cut(s)	127, 165
BstFNI	CGCG	3 cut(s)	44, 111, 380
BstKTI	GATC	1 cut(s)	127
BstMBI	GATC	1 cut(s)	124
BstMWI	GCNNNNNNNGC	2 cut(s)	203, 296
BstNI	CCWGG	1 cut(s)	203
BstNSI	RCATGY	1 cut(s)	142
BstSCI	CCNGG	1 cut(s)	201
BstSFI	CTRYAG	1 cut(s)	168
BstUI	CGCG	3 cut(s)	44, 111, 380
BstV2I	GAAGAC	1 cut(s)	276
BstXI	CCANNNNNNTGG	1 cut(s)	286
BsuRI	GGCC	7 cut(s)	23, 114, 131, 206, 290, 342, 384
BtgI	CCRYGG	1 cut(s)	42
BtsCI	GGATG	2 cut(s)	127, 165
Cac8I	GCNNGC	5 cut(s)	136, 140, 199, 340, 382
Cfr13I	GGNCC	5 cut(s)	22, 129, 205, 289, 382
Cfr42I	CCGCGG	1 cut(s)	45
CviAII	CATG	2 cut(s)	139, 218
DdeI	CTNAG	1 cut(s)	224
DpnI	GATC	1 cut(s)	126
DpnII	GATC	1 cut(s)	124
EaeI	YGGCCR	1 cut(s)	112
Ecl136II	GAGCTC	1 cut(s)	223
Eco130I	CCWWGG	1 cut(s)	255
Eco147I	AGGCCT	1 cut(s)	342
Eco24I	GRGCYC	2 cut(s)	58, 225
Eco53kI	GAGCTC	1 cut(s)	223
Eco57I	CTGAAG	1 cut(s)	288
Eco88I	CYCGRG	1 cut(s)	51
EcoICRI	GAGCTC	1 cut(s)	223
EcoRII	CCWGG	1 cut(s)	201
EcoT14I	CCWWGG	1 cut(s)	255
EcoT38I	GRGCYC	2 cut(s)	58, 225
ErhI	CCWWGG	1 cut(s)	255
FaeI	CATG	2 cut(s)	142, 221
FaiI	YATR	3 cut(s)	78, 140, 219
FatI	CATG	2 cut(s)	138, 217
FauI	CCCGC	3 cut(s)	49, 135, 373
FblI	GTMKAC	1 cut(s)	164
Fnu4HI	GCNGC	4 cut(s)	112, 132, 336, 385
FokI	GGATG	2 cut(s)	134, 172
FriOI	GRGCYC	2 cut(s)	58, 225
Fsp4HI	GCNGC	4 cut(s)	112, 132, 336, 385
FspBI	CTAG	1 cut(s)	245
GluI	GCNGC	4 cut(s)	112, 132, 336, 385
HaeIII	GGCC	7 cut(s)	23, 114, 131, 206, 290, 342, 384
Hin1II	CATG	2 cut(s)	142, 221
HincII	GTYRAC	2 cut(s)	67, 165
HindII	GTYRAC	2 cut(s)	67, 165
HindIII	AAGCTT	1 cut(s)	368
HinfI	GANTC	1 cut(s)	228
HpaI	GTTAAC	1 cut(s)	67
Hpy166II	GTNNAC	3 cut(s)	67, 165, 331
Hpy188I	TCNGA	4 cut(s)	159, 185, 227, 268
Hpy8I	GTNNAC	3 cut(s)	67, 165, 331
HpyAV	CCTTC	1 cut(s)	353
HpyCH4III	ACNGT	1 cut(s)	169
HpyF10VI	GCNNNNNNNGC	2 cut(s)	203, 296
HpyF3I	CTNAG	1 cut(s)	224
Hsp92II	CATG	2 cut(s)	142, 221
KspAI	GTTAAC	1 cut(s)	67
KspI	CCGCGG	1 cut(s)	45
Kzo9I	GATC	1 cut(s)	124
LpnPI	CCDG	4 cut(s)	188, 211, 215, 324
LweI	GCATC	1 cut(s)	345
MaeI	CTAG	1 cut(s)	245
MalI	GATC	1 cut(s)	126
MbiI	CCGCTC	1 cut(s)	134
MboI	GATC	1 cut(s)	124
MboII	GAAGA	1 cut(s)	281
MfeI	CAATTG	1 cut(s)	116
MhlI	GDGCHC	2 cut(s)	58, 225
MluCI	AATT	1 cut(s)	116
MmeI	TCCRAC	1 cut(s)	208
MnlI	CCTC	3 cut(s)	40, 64, 226
MseI	TTAA	1 cut(s)	66
MspA1I	CMGCKG	1 cut(s)	44
MspR9I	CCNGG	1 cut(s)	203
MunI	CAATTG	1 cut(s)	116
MvaI	CCWGG	1 cut(s)	203
MvnI	CGCG	3 cut(s)	44, 111, 380
MwoI	GCNNNNNNNGC	2 cut(s)	203, 296
NdeII	GATC	1 cut(s)	124
NlaIII	CATG	2 cut(s)	142, 221
NspI	RCATGY	1 cut(s)	142
PaeI	GCATGC	1 cut(s)	142
PceI	AGGCCT	1 cut(s)	342
PfeI	GAWTC	1 cut(s)	228
PkrI	GCNGC	4 cut(s)	113, 133, 337, 386
Psp124BI	GAGCTC	1 cut(s)	225
Psp6I	CCWGG	1 cut(s)	201
PspGI	CCWGG	1 cut(s)	201
PspPI	GGNCC	5 cut(s)	22, 129, 205, 289, 382
PsrI	GAACNNNNNNTAC	2 cut(s)	90, 122
SacI	GAGCTC	1 cut(s)	225
SacII	CCGCGG	1 cut(s)	45
SalI	GTCGAC	1 cut(s)	163
SaqAI	TTAA	1 cut(s)	66
SatI	GCNGC	4 cut(s)	112, 132, 336, 385
Sau3AI	GATC	1 cut(s)	124
Sau96I	GGNCC	5 cut(s)	22, 129, 205, 289, 382
ScrFI	CCNGG	1 cut(s)	203
SduI	GDGCHC	2 cut(s)	58, 225
SetI	ASST	3 cut(s)	87, 225, 372
SfaNI	GCATC	1 cut(s)	345
SfcI	CTRYAG	1 cut(s)	168
Sfr303I	CCGCGG	1 cut(s)	45
SgrBI	CCGCGG	1 cut(s)	45
SphI	GCATGC	1 cut(s)	142
Sse9I	AATT	1 cut(s)	116
SseBI	AGGCCT	1 cut(s)	342
SsiI	CCGC	9 cut(s)	42, 44, 111, 132, 142, 297, 336, 380, 385
SspMI	CTAG	1 cut(s)	245
SstI	GAGCTC	1 cut(s)	225
StuI	AGGCCT	1 cut(s)	342
StyD4I	CCNGG	1 cut(s)	201
StyI	CCWWGG	1 cut(s)	255
TaaI	ACNGT	1 cut(s)	169
TaqI	TCGA	3 cut(s)	15, 164, 231
TasI	AATT	1 cut(s)	116
TauI	GCSGC	4 cut(s)	114, 134, 338, 387
TfiI	GAWTC	1 cut(s)	228
Tru1I	TTAA	1 cut(s)	66
Tru9I	TTAA	1 cut(s)	66
TspDTI	ATGAA	1 cut(s)	227
XceI	RCATGY	1 cut(s)	142
XmiI	GTMKAC	1 cut(s)	164
XspI	CTAG	1 cut(s)	245

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.