RchiOBHm_Chr5g0007261

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0001097
Physical Location & Seq
Reverse (-)
4593195 .. 4593802
608 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ28833

Sequence Viewer

Length: 213 bp
ATGACGGGAGAAGTGATCCCTGCAGTATTCGCGTTCAGGCATTGTGCAAATTCTCCTGATTTTGATGGTCTGATGTGGGAGATTGCAGTTTGTGTCTTCATTACCGTGTATCTAATTCTCATATATGTATGTACGTTGCAATGTAGATCCTTCAATGATATAAATATAAAAATTAAAAATATATGTTCAAAACTTTGCGATTCTGGGACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.87

Weight (kDa)

5.53

Isoelectric Point (pI)

47.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 32
AclWI GGATC 2 cut(s) 10, 141
AcsI RAATTY 1 cut(s) 49
AfaI GTAC 1 cut(s) 133
AgsI TTSAA 2 cut(s) 154, 189
AlwI GGATC 2 cut(s) 10, 141
ApoI RAATTY 1 cut(s) 49
BbsI GAAGAC 1 cut(s) 88
BccI CCATC 1 cut(s) 59
BfmI CTRYAG 1 cut(s) 21
BpiI GAAGAC 1 cut(s) 88
Bse3DI GCAATG 1 cut(s) 146
BseMI GCAATG 1 cut(s) 146
Bsh1236I CGCG 1 cut(s) 32
Bsp143I GATC 2 cut(s) 15, 146
BspFNI CGCG 1 cut(s) 32
BspMAI CTGCAG 1 cut(s) 25
BspPI GGATC 2 cut(s) 10, 141
BsrDI GCAATG 1 cut(s) 146
BssMI GATC 2 cut(s) 15, 146
Bst4CI ACNGT 1 cut(s) 106
BstFNI CGCG 1 cut(s) 32
BstKTI GATC 2 cut(s) 18, 149
BstMBI GATC 2 cut(s) 15, 146
BstMWI GCNNNNNNNGC 1 cut(s) 29
BstSFI CTRYAG 1 cut(s) 21
BstUI CGCG 1 cut(s) 32
BstV2I GAAGAC 1 cut(s) 88
BstX2I RGATCY 1 cut(s) 146
BstYI RGATCY 1 cut(s) 146
Csp6I GTAC 1 cut(s) 132
CviAII CATG 1 cut(s) 210
CviQI GTAC 1 cut(s) 132
DpnI GATC 2 cut(s) 17, 148
DpnII GATC 2 cut(s) 15, 146
FaeI CATG 1 cut(s) 213
FaiI YATR 9 cut(s) 122, 124, 126, 130, 161, 167, 182, 184, 211
FatI CATG 1 cut(s) 209
Hin1II CATG 1 cut(s) 213
HinfI GANTC 1 cut(s) 200
Hpy188I TCNGA 1 cut(s) 72
Hpy188III TCNNGA 1 cut(s) 56
HpyAV CCTTC 1 cut(s) 160
HpyCH4III ACNGT 1 cut(s) 106
HpyCH4IV ACGT 1 cut(s) 134
HpyCH4V TGCA 4 cut(s) 23, 47, 86, 139
HpyF10VI GCNNNNNNNGC 1 cut(s) 29
HpySE526I ACGT 1 cut(s) 134
Hsp92II CATG 1 cut(s) 213
Kzo9I GATC 2 cut(s) 15, 146
LpnPI CCDG 4 cut(s) 22, 33, 69, 189
MaeII ACGT 1 cut(s) 134
MalI GATC 2 cut(s) 17, 148
MboI GATC 2 cut(s) 15, 146
MboII GAAGA 1 cut(s) 88
MflI RGATCY 1 cut(s) 146
MluCI AATT 3 cut(s) 49, 114, 171
MseI TTAA 1 cut(s) 174
MslI CAYNNNNRTG 1 cut(s) 104
MvnI CGCG 1 cut(s) 32
MwoI GCNNNNNNNGC 1 cut(s) 29
NdeII GATC 2 cut(s) 15, 146
NlaIII CATG 1 cut(s) 213
PfeI GAWTC 1 cut(s) 200
PstI CTGCAG 1 cut(s) 25
PsuI RGATCY 1 cut(s) 146
RsaI GTAC 1 cut(s) 133
RsaNI GTAC 1 cut(s) 132
RseI CAYNNNNRTG 1 cut(s) 104
SaqAI TTAA 1 cut(s) 174
Sau3AI GATC 2 cut(s) 15, 146
SetI ASST 1 cut(s) 137
SfcI CTRYAG 1 cut(s) 21
SgeI CNNG 6 cut(s) 18, 32, 43, 49, 68, 118
SmiMI CAYNNNNRTG 1 cut(s) 104
Sse9I AATT 3 cut(s) 49, 114, 171
TaaI ACNGT 1 cut(s) 106
TaiI ACGT 1 cut(s) 137
TasI AATT 3 cut(s) 49, 114, 171
TfiI GAWTC 1 cut(s) 200
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TspDTI ATGAA 1 cut(s) 88
XapI RAATTY 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.