RchiOBHm_Chr5g0057251

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0002864
Physical Location & Seq
Reverse (-)
61144733 .. 61149681
4949 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33404

Sequence Viewer

Length: 159 bp
ATGGGCCAGGAACTTGAAGAACAAGCAGCGCCGTCGGTCATCCTCCGATGGCAAGATTTGGGTGAGTTACCAGAAAACGAGCTGATTGTTAAGGCTCCCGAAGACAATACCCCTCCTCGTGGGAAAGGGAAAGGGAACAAAGGGAAAGTGAAAGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.67

Weight (kDa)

5.29

Isoelectric Point (pI)

57.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 119
AgsI TTSAA 1 cut(s) 17
AjnI CCWGG 1 cut(s) 6
AluBI AGCT 1 cut(s) 82
AluI AGCT 1 cut(s) 82
AoxI GGCC 1 cut(s) 4
ApeKI GCWGC 1 cut(s) 26
AspLEI GCGC 1 cut(s) 31
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 74
BauI CACGAG 1 cut(s) 117
BbsI GAAGAC 1 cut(s) 108
BbvI GCAGC 1 cut(s) 38
BccI CCATC 1 cut(s) 42
BceAI ACGGC 1 cut(s) 16
BcgI CGANNNNNNTGC 2 cut(s) 15, 49
BciT130I CCWGG 1 cut(s) 8
BfoI RGCGCY 1 cut(s) 32
BisI GCNGC 1 cut(s) 27
BlsI GCNGC 1 cut(s) 28
Bme1390I CCNGG 1 cut(s) 8
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 96
BmrFI CCNGG 1 cut(s) 8
BpiI GAAGAC 1 cut(s) 108
Bsc4I CCNNNNNNNGG 1 cut(s) 119
BseBI CCWGG 1 cut(s) 8
BseGI GGATG 1 cut(s) 39
BseLI CCNNNNNNNGG 1 cut(s) 119
BseRI GAGGAG 1 cut(s) 105
BseXI GCAGC 1 cut(s) 38
BshFI GGCC 1 cut(s) 6
BslI CCNNNNNNNGG 1 cut(s) 119
BsnI GGCC 1 cut(s) 6
BspANI GGCC 1 cut(s) 6
BspLI GGNNCC 1 cut(s) 96
BssSI CACGAG 1 cut(s) 117
Bst2BI CACGAG 1 cut(s) 117
Bst2UI CCWGG 1 cut(s) 8
BstF5I GGATG 1 cut(s) 39
BstH2I RGCGCY 1 cut(s) 32
BstHHI GCGC 1 cut(s) 31
BstNI CCWGG 1 cut(s) 8
BstSCI CCNGG 1 cut(s) 6
BstV1I GCAGC 1 cut(s) 38
BstV2I GAAGAC 1 cut(s) 108
BsuRI GGCC 1 cut(s) 6
BtsCI GGATG 1 cut(s) 39
CfoI GCGC 1 cut(s) 31
Cfr13I GGNCC 1 cut(s) 4
CviJI RGCY 3 cut(s) 6, 82, 95
CviKI_1 RGCY 3 cut(s) 6, 82, 95
EcoRII CCWGG 1 cut(s) 6
FaiI YATR 1 cut(s) 157
Fnu4HI GCNGC 1 cut(s) 27
FokI GGATG 1 cut(s) 26
Fsp4HI GCNGC 1 cut(s) 27
GlaI GCGC 1 cut(s) 30
GluI GCNGC 1 cut(s) 27
HaeII RGCGCY 1 cut(s) 32
HaeIII GGCC 1 cut(s) 6
HhaI GCGC 1 cut(s) 31
Hin6I GCGC 1 cut(s) 29
HinP1I GCGC 1 cut(s) 29
HphI GGTGA 1 cut(s) 74
Hpy188I TCNGA 1 cut(s) 47
Hpy188III TCNNGA 1 cut(s) 98
Hpy99I CGWCG 1 cut(s) 37
HspAI GCGC 1 cut(s) 29
LmnI GCTCC 1 cut(s) 100
LpnPI CCDG 2 cut(s) 20, 84
Lsp1109I GCAGC 1 cut(s) 38
MaeIII GTNAC 1 cut(s) 66
MboII GAAGA 2 cut(s) 29, 113
MnlI CCTC 3 cut(s) 53, 123, 126
MseI TTAA 1 cut(s) 90
MspR9I CCNGG 1 cut(s) 8
MvaI CCWGG 1 cut(s) 8
NlaIV GGNNCC 1 cut(s) 96
PkrI GCNGC 1 cut(s) 28
Psp6I CCWGG 1 cut(s) 6
PspGI CCWGG 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 96
PspPI GGNCC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 90
SatI GCNGC 1 cut(s) 27
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 1 cut(s) 8
SetI ASST 1 cut(s) 84
StyD4I CCNGG 1 cut(s) 6
TaqII GACCGA 1 cut(s) 25
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
TseI GCWGC 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.