RchiOBHm_Chr7g0226121

belongs to the flavoprotein pyridine nucleotide cytochrome reductase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
49180444 .. 49181029
586 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20252

Sequence Viewer

Length: 147 bp
ATGGCACCATCTAGAATTCATGTTACTTGTGCACTAGTTTGTGACAAAACATCAACAGGAAGGATTCACAAAGGAGTGTGTTCAACATGGATGAAGCAACCGTGGAGGAGAACTGATATTAGAAGACCTCTCAAGCTGAAATACTGA

Protein Analysis

48

Amino Acids

5.63

Weight (kDa)

10.62

Isoelectric Point (pI)

64.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 4
AcsI RAATTY 1 cut(s) 15
AgsI TTSAA 1 cut(s) 84
AhlI ACTAGT 1 cut(s) 34
AluBI AGCT 1 cut(s) 136
AluI AGCT 1 cut(s) 136
Alw21I GWGCWC 1 cut(s) 34
Alw44I GTGCAC 1 cut(s) 30
ApaLI GTGCAC 1 cut(s) 30
ApoI RAATTY 1 cut(s) 15
BaeGI GKGCMC 1 cut(s) 34
BanI GGYRCC 1 cut(s) 4
BbsI GAAGAC 1 cut(s) 130
Bbv12I GWGCWC 1 cut(s) 34
BccI CCATC 1 cut(s) 16
BcuI ACTAGT 1 cut(s) 34
BfaI CTAG 2 cut(s) 12, 35
BmiI GGNNCC 1 cut(s) 6
BpiI GAAGAC 1 cut(s) 130
BpuEI CTTGAG 1 cut(s) 116
BsaJI CCNNGG 1 cut(s) 101
BseDI CCNNGG 1 cut(s) 101
BseGI GGATG 1 cut(s) 96
BseRI GAGGAG 1 cut(s) 121
BseSI GKGCMC 1 cut(s) 34
BshNI GGYRCC 1 cut(s) 4
BsiHKAI GWGCWC 1 cut(s) 34
Bsp1286I GDGCHC 1 cut(s) 34
BspLI GGNNCC 1 cut(s) 6
BspT107I GGYRCC 1 cut(s) 4
BssECI CCNNGG 1 cut(s) 101
Bst4CI ACNGT 1 cut(s) 102
BstDSI CCRYGG 1 cut(s) 101
BstF5I GGATG 1 cut(s) 96
BstSLI GKGCMC 1 cut(s) 34
BstV2I GAAGAC 1 cut(s) 130
BtgI CCRYGG 1 cut(s) 101
BtsCI GGATG 1 cut(s) 96
CviAII CATG 2 cut(s) 20, 87
CviJI RGCY 1 cut(s) 136
CviKI_1 RGCY 1 cut(s) 136
EcoRI GAATTC 1 cut(s) 15
FaeI CATG 2 cut(s) 23, 90
FaiI YATR 2 cut(s) 21, 88
FatI CATG 2 cut(s) 19, 86
FokI GGATG 1 cut(s) 103
FspBI CTAG 2 cut(s) 12, 35
FspEI CC 9 cut(s) 21, 42, 46, 57, 73, 88, 91, 114, 141
Hin1II CATG 2 cut(s) 23, 90
HinfI GANTC 1 cut(s) 64
Hpy166II GTNNAC 1 cut(s) 32
Hpy188III TCNNGA 1 cut(s) 12
Hpy8I GTNNAC 1 cut(s) 32
HpyAV CCTTC 1 cut(s) 54
HpyCH4III ACNGT 1 cut(s) 102
HpyCH4V TGCA 1 cut(s) 32
Hsp92II CATG 2 cut(s) 23, 90
LpnPI CCDG 1 cut(s) 42
MaeI CTAG 2 cut(s) 12, 35
MaeIII GTNAC 2 cut(s) 22, 41
MboII GAAGA 1 cut(s) 135
MhlI GDGCHC 1 cut(s) 34
MluCI AATT 1 cut(s) 15
MnlI CCTC 2 cut(s) 99, 138
NlaIII CATG 2 cut(s) 23, 90
NlaIV GGNNCC 1 cut(s) 6
NmuCI GTSAC 1 cut(s) 41
PfeI GAWTC 1 cut(s) 64
PspN4I GGNNCC 1 cut(s) 6
SduI GDGCHC 1 cut(s) 34
SetI ASST 2 cut(s) 130, 138
SgeI CNNG 7 cut(s) 24, 32, 39, 47, 69, 99, 114
SmlI CTYRAG 1 cut(s) 131
SmoI CTYRAG 1 cut(s) 131
SpeI ACTAGT 1 cut(s) 34
Sse9I AATT 1 cut(s) 15
SspMI CTAG 2 cut(s) 12, 35
TaaI ACNGT 1 cut(s) 102
TasI AATT 1 cut(s) 15
TfiI GAWTC 1 cut(s) 64
TseFI GTSAC 1 cut(s) 41
Tsp45I GTSAC 1 cut(s) 41
TspDTI ATGAA 2 cut(s) 8, 107
VneI GTGCAC 1 cut(s) 30
XapI RAATTY 1 cut(s) 15
XbaI TCTAGA 1 cut(s) 11
XspI CTAG 2 cut(s) 12, 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.