Rh4CG004400

belongs to the flavoprotein pyridine nucleotide cytochrome reductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0002068
Physical Location & Seq
Forward (+)
823667 .. 824758
1092 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG004400.1

Sequence Viewer

Length: 372 bp
ATGATTGGTCCTGGAACTGGATTTGCTCCTTTCAGGGATTTCTTGCAGGAAAGATTAGCTCTTACAGAAGATGGAGCAGAACTTGGACCCTCCGTATTATTCTTTGGATGCAGAAATAGTCAAATGGACTACACTTACAAAAATGAGCTGAACAACTTCGTAGAAAAAGGTGCACTTTCTGATCTTGTGGTTGCATTCTCCTGCCAGGGACACACCAAGGAATATGTTTCCGACATCTGGAACATGCTATCTCAAAGAGGTTATATTTACGTTTGTGGTGATGCTAAGGGCATGGCCAGGGATGATGAAAATAAAAGCATCTCAAATGAAGGCAGATGGCCCAACCACAAGTTGCATGCTACAAGAATCTGA

Protein Analysis

123

Amino Acids

13.86

Weight (kDa)

5.55

Isoelectric Point (pI)

29.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAD_binding_1 PF00175 1 - 101 2.7e-12 Oxidoreductase NAD-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 294
AfiI CCNNNNNNNGG 2 cut(s) 17, 237
AjnI CCWGG 3 cut(s) 10, 204, 296
AluBI AGCT 2 cut(s) 59, 148
AluI AGCT 2 cut(s) 59, 148
Alw21I GWGCWC 1 cut(s) 175
Alw44I GTGCAC 1 cut(s) 171
AoxI GGCC 2 cut(s) 294, 338
ApaLI GTGCAC 1 cut(s) 171
Asp700I GAANNNNTTC 1 cut(s) 155
AspS9I GGNCC 3 cut(s) 8, 86, 339
AsuHPI GGTGA 1 cut(s) 290
AvaII GGWCC 2 cut(s) 8, 86
BaeGI GKGCMC 1 cut(s) 175
BalI TGGCCA 1 cut(s) 296
Bbv12I GWGCWC 1 cut(s) 175
BccI CCATC 2 cut(s) 65, 330
BciT130I CCWGG 3 cut(s) 12, 206, 298
Bme1390I CCNGG 3 cut(s) 12, 206, 298
Bme18I GGWCC 2 cut(s) 8, 86
BmgT120I GGNCC 3 cut(s) 8, 86, 339
BmiI GGNNCC 1 cut(s) 88
BmrFI CCNGG 3 cut(s) 12, 206, 298
BmsI GCATC 3 cut(s) 98, 271, 327
Bpu10I CCTNAGC 1 cut(s) 285
BsaJI CCNNGG 3 cut(s) 205, 216, 297
Bsc4I CCNNNNNNNGG 2 cut(s) 17, 237
Bse1I ACTGG 1 cut(s) 22
BseBI CCWGG 3 cut(s) 12, 206, 298
BseDI CCNNGG 3 cut(s) 205, 216, 297
BseGI GGATG 2 cut(s) 113, 307
BseLI CCNNNNNNNGG 2 cut(s) 17, 237
BseNI ACTGG 1 cut(s) 22
BseSI GKGCMC 1 cut(s) 175
BshFI GGCC 2 cut(s) 296, 340
BsiHKAI GWGCWC 1 cut(s) 175
BslFI GGGAC 1 cut(s) 222
BslI CCNNNNNNNGG 2 cut(s) 17, 237
BsmFI GGGAC 1 cut(s) 222
BsmI GAATGC 1 cut(s) 194
BsnI GGCC 2 cut(s) 296, 340
Bsp1286I GDGCHC 1 cut(s) 175
Bsp143I GATC 1 cut(s) 181
BspANI GGCC 2 cut(s) 296, 340
BspLI GGNNCC 1 cut(s) 88
BsrI ACTGG 1 cut(s) 22
BssECI CCNNGG 3 cut(s) 205, 216, 297
BssMI GATC 1 cut(s) 181
BssT1I CCWWGG 1 cut(s) 216
Bst2UI CCWGG 3 cut(s) 12, 206, 298
BstC8I GCNNGC 1 cut(s) 357
BstDEI CTNAG 1 cut(s) 285
BstF5I GGATG 2 cut(s) 113, 307
BstKTI GATC 1 cut(s) 184
BstMBI GATC 1 cut(s) 181
BstNI CCWGG 3 cut(s) 12, 206, 298
BstNSI RCATGY 2 cut(s) 247, 359
BstSCI CCNGG 3 cut(s) 10, 204, 296
BstSLI GKGCMC 1 cut(s) 175
BsuRI GGCC 2 cut(s) 296, 340
BtsCI GGATG 2 cut(s) 113, 307
Cac8I GCNNGC 1 cut(s) 357
Cfr13I GGNCC 3 cut(s) 8, 86, 339
CviAII CATG 3 cut(s) 244, 292, 356
CviJI RGCY 4 cut(s) 59, 148, 296, 340
CviKI_1 RGCY 4 cut(s) 59, 148, 296, 340
DdeI CTNAG 1 cut(s) 285
DpnI GATC 1 cut(s) 183
DpnII GATC 1 cut(s) 181
EaeI YGGCCR 1 cut(s) 294
Eco130I CCWWGG 1 cut(s) 216
Eco47I GGWCC 2 cut(s) 8, 86
EcoRII CCWGG 3 cut(s) 10, 204, 296
EcoT14I CCWWGG 1 cut(s) 216
ErhI CCWWGG 1 cut(s) 216
FaeI CATG 3 cut(s) 247, 295, 359
FaiI YATR 5 cut(s) 225, 245, 264, 293, 357
FalI AAGNNNNNCTT 2 cut(s) 159, 191
FaqI GGGAC 1 cut(s) 222
FatI CATG 3 cut(s) 243, 291, 355
FokI GGATG 2 cut(s) 120, 314
HaeIII GGCC 2 cut(s) 296, 340
Hin1II CATG 3 cut(s) 247, 295, 359
HinfI GANTC 1 cut(s) 366
HphI GGTGA 1 cut(s) 290
Hpy166II GTNNAC 1 cut(s) 173
Hpy188I TCNGA 3 cut(s) 181, 232, 371
Hpy188III TCNNGA 1 cut(s) 238
Hpy8I GTNNAC 1 cut(s) 173
HpyAV CCTTC 1 cut(s) 323
HpyCH4IV ACGT 1 cut(s) 270
HpyCH4V TGCA 5 cut(s) 46, 111, 173, 194, 355
HpyF3I CTNAG 1 cut(s) 285
HpySE526I ACGT 1 cut(s) 270
Hsp92II CATG 3 cut(s) 247, 295, 359
Kzo9I GATC 1 cut(s) 181
LmnI GCTCC 2 cut(s) 31, 74
LweI GCATC 3 cut(s) 98, 271, 327
MaeII ACGT 1 cut(s) 270
MalI GATC 1 cut(s) 183
MboI GATC 1 cut(s) 181
MboII GAAGA 1 cut(s) 80
MhlI GDGCHC 1 cut(s) 175
MlsI TGGCCA 1 cut(s) 296
MluNI TGGCCA 1 cut(s) 296
MmeI TCCRAC 1 cut(s) 255
MnlI CCTC 2 cut(s) 100, 251
Mox20I TGGCCA 1 cut(s) 296
MroXI GAANNNNTTC 1 cut(s) 155
MscI TGGCCA 1 cut(s) 296
Msp20I TGGCCA 1 cut(s) 296
MspR9I CCNGG 3 cut(s) 12, 206, 298
Mva1269I GAATGC 1 cut(s) 194
MvaI CCWGG 3 cut(s) 12, 206, 298
NdeII GATC 1 cut(s) 181
NlaIII CATG 3 cut(s) 247, 295, 359
NlaIV GGNNCC 1 cut(s) 88
NspI RCATGY 2 cut(s) 247, 359
PaeI GCATGC 1 cut(s) 359
PctI GAATGC 1 cut(s) 194
PdmI GAANNNNTTC 1 cut(s) 155
PfeI GAWTC 1 cut(s) 366
PfoI TCCNGGA 1 cut(s) 10
Psp6I CCWGG 3 cut(s) 10, 204, 296
PspGI CCWGG 3 cut(s) 10, 204, 296
PspN4I GGNNCC 1 cut(s) 88
PspPI GGNCC 3 cut(s) 8, 86, 339
Sau3AI GATC 1 cut(s) 181
Sau96I GGNCC 3 cut(s) 8, 86, 339
ScrFI CCNGG 3 cut(s) 12, 206, 298
SduI GDGCHC 1 cut(s) 175
SetI ASST 5 cut(s) 61, 150, 172, 262, 273
SfaNI GCATC 3 cut(s) 98, 271, 327
SinI GGWCC 2 cut(s) 8, 86
SphI GCATGC 1 cut(s) 359
StyD4I CCNGG 3 cut(s) 10, 204, 296
StyI CCWWGG 1 cut(s) 216
TaiI ACGT 1 cut(s) 273
TfiI GAWTC 1 cut(s) 366
TspDTI ATGAA 2 cut(s) 321, 342
TspGWI ACGGA 1 cut(s) 82
VneI GTGCAC 1 cut(s) 171
VpaK11BI GGWCC 2 cut(s) 8, 86
XceI RCATGY 2 cut(s) 247, 359
XmnI GAANNNNTTC 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.