RLG00000014316

Belongs to the multicopper oxidase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
OG0000659
Physical Location & Seq
Reverse (-)
51206401 .. 51213909
7509 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000014316

Sequence Viewer

Length: 435 bp
ATGTTCCCTGGACCTACAATCTATGCTAGAGAAGGCGATACAGTTCTATGGAATAGCGATGTTGAAGAGGTTGTTAAACAAGGGAACAGTCTGGGATTGCCTCCGACTATGTCAGATGCACATACCATTAATGGGAAGCCAGGGCAGCTCTTTCCTTGTTCTGAAAAAGATATCTTTGCAATGGAGGTTGAACAGGAAAAGACTTACCTGCTACAGATCGTCAATGTTGCGCTTAATGACGAGCTATTCTTTGCAATTGCTAACCATAACTTGATAGTGGTAGAGGTTGATGCAGTCTATAACAAACCATTTACATCTCAGGCAATACTAATTACACCAGGCCAGACCACAAATGTTCTTGTTCAGGCAAACCAAGTCCCTAGCAGATACTTCATGGCTGCAAGGTCATTCATGCATTCACCTCTCTTTCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cu-oxidase Cu-oxidase_2 Cu-oxidase_3 Pectinesterase

Protein Analysis

145

Amino Acids

15.99

Weight (kDa)

4.73

Isoelectric Point (pI)

44.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu-oxidase PF00394 17 - 137 2e-33 Multicopper oxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000659)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G03260
fragaria_vesca FvH4_1g13060 FvH4_2g08670 FvH4_2g08670 FvH4_2g08670 FvH4_2g08840 FvH4_2g08860 FvH4_2g09061
malus_domestica MD02G1145100.v1.1 MD05G1064600.v1.1 MD10G1073700.v1.1 MD15G1258600.v1.1 MD15G1259300.v1.1
prunus_persica Prupe.6G177700_v2.0.a1 Prupe.7G156500_v2.0.a1 Prupe.8G095000_v2.0.a1 Prupe.8G095400_v2.0.a1 Prupe.8G097000_v2.0.a1
pyrus_communis pycom02g11490 pycom05g05550 pycom15g22710
rosa_chinensis RchiOBHm_Chr2g0101231 RchiOBHm_Chr6g0264061 RchiOBHm_Chr6g0264101 RchiOBHm_Chr6g0264311 RchiOBHm_Chr6g0264361 RchiOBHm_Chr6g0264441 RchiOBHm_Chr6g0264891
rosa_laevigata RLG00000014229 RLG00000014253 RLG00000014265 RLG00000014267 RLG00000014269 RLG00000014291 RLG00000014292 RLG00000014316 RLG00000017063
rosa_multiflora Rmu_co8391921.1_g000001 Rmu_co8519839.1_g000001 Rmu_sc0000546.1_g000055 Rmu_sc0002305.1_g000003 Rmu_sc0004470.1_g000004 Rmu_sc0006314.1_g000014 Rmu_sc0009807.1_g000001 Rmu_sc0010483.1_g000004
rosa_roxburghii Rroxscaffold_175G00432050 Rroxscaffold_176G00431400 Rroxscaffold_176G00431740 Rroxscaffold_176G00431790 Rroxscaffold_7G00203140 Rroxscaffold_7G00203620
rosa_rugosa Rorug02G0100200 Rorug06G0007600 Rorug06G0012500 Rorug06G0012600 Rorug06G0014100
rosa_samantha Rh2BG150700 Rh2DG150800 Rh6AG128900 Rh6AG131700 Rh6BG124500 Rh6BG124800 Rh6BG128400 Rh6BG129400 Rh6BG132600 Rh6CG123100 Rh6DG110500 Rh6DG113900 Rh6DG114900 Rh6DG118200
rosa_wichuraiana Rw2G011330 Rw6G011140 Rw6G011160 Rw6G011480 Rw6G011540 Rw6G011680

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 216
AfiI CCNNNNNNNGG 1 cut(s) 132
AgsI TTSAA 2 cut(s) 65, 191
AjnI CCWGG 3 cut(s) 7, 139, 337
AluBI AGCT 2 cut(s) 148, 244
AluI AGCT 2 cut(s) 148, 244
AoxI GGCC 1 cut(s) 340
ApeKI GCWGC 2 cut(s) 145, 398
AseI ATTAAT 1 cut(s) 129
AspLEI GCGC 1 cut(s) 232
AspS9I GGNCC 1 cut(s) 11
AsuHPI GGTGA 1 cut(s) 411
AvaII GGWCC 1 cut(s) 11
BbvI GCAGC 2 cut(s) 157, 385
BciT130I CCWGG 3 cut(s) 9, 141, 339
BfaI CTAG 2 cut(s) 27, 381
BfmI CTRYAG 1 cut(s) 212
BfuAI ACCTGC 1 cut(s) 216
BisI GCNGC 2 cut(s) 146, 399
BlsI GCNGC 2 cut(s) 147, 400
Bme1390I CCNGG 3 cut(s) 9, 141, 339
Bme18I GGWCC 1 cut(s) 11
BmgT120I GGNCC 1 cut(s) 11
BmrFI CCNGG 3 cut(s) 9, 141, 339
BmsI GCATC 2 cut(s) 106, 280
BsaJI CCNNGG 2 cut(s) 7, 140
Bsc4I CCNNNNNNNGG 1 cut(s) 132
Bse3DI GCAATG 1 cut(s) 186
BseBI CCWGG 3 cut(s) 9, 141, 339
BseDI CCNNGG 2 cut(s) 7, 140
BseLI CCNNNNNNNGG 1 cut(s) 132
BseMI GCAATG 1 cut(s) 186
BseMII CTCAG 1 cut(s) 332
BseXI GCAGC 2 cut(s) 157, 385
BshFI GGCC 1 cut(s) 342
BslFI GGGAC 1 cut(s) 362
BslI CCNNNNNNNGG 1 cut(s) 132
BsmFI GGGAC 1 cut(s) 362
BsmI GAATGC 1 cut(s) 415
BsnI GGCC 1 cut(s) 342
Bsp143I GATC 1 cut(s) 216
BspANI GGCC 1 cut(s) 342
BspCNI CTCAG 1 cut(s) 331
BspMI ACCTGC 1 cut(s) 216
BsrDI GCAATG 1 cut(s) 186
BssECI CCNNGG 2 cut(s) 7, 140
BssMI GATC 1 cut(s) 216
Bst2UI CCWGG 3 cut(s) 9, 141, 339
Bst4CI ACNGT 2 cut(s) 43, 89
Bst6I CTCTTC 1 cut(s) 60
BstDEI CTNAG 1 cut(s) 318
BstHHI GCGC 1 cut(s) 232
BstKTI GATC 1 cut(s) 219
BstMBI GATC 1 cut(s) 216
BstMWI GCNNNNNNNGC 1 cut(s) 145
BstNI CCWGG 3 cut(s) 9, 141, 339
BstSCI CCNGG 3 cut(s) 7, 139, 337
BstSFI CTRYAG 1 cut(s) 212
BstV1I GCAGC 2 cut(s) 157, 385
BsuRI GGCC 1 cut(s) 342
BtgZI GCGATG 1 cut(s) 72
BveI ACCTGC 1 cut(s) 216
CfoI GCGC 1 cut(s) 232
Cfr13I GGNCC 1 cut(s) 11
CviAII CATG 2 cut(s) 394, 412
CviJI RGCY 5 cut(s) 139, 148, 244, 342, 398
CviKI_1 RGCY 5 cut(s) 139, 148, 244, 342, 398
DdeI CTNAG 1 cut(s) 318
DpnI GATC 1 cut(s) 218
DpnII GATC 1 cut(s) 216
Eam1104I CTCTTC 1 cut(s) 60
EarI CTCTTC 1 cut(s) 60
Eco32I GATATC 1 cut(s) 172
Eco47I GGWCC 1 cut(s) 11
EcoRII CCWGG 3 cut(s) 7, 139, 337
EcoRV GATATC 1 cut(s) 172
EcoT22I ATGCAT 1 cut(s) 417
FaeI CATG 2 cut(s) 397, 415
FaiI YATR 9 cut(s) 24, 49, 110, 123, 267, 300, 395, 413, 433
FaqI GGGAC 1 cut(s) 362
FatI CATG 2 cut(s) 393, 411
Fnu4HI GCNGC 2 cut(s) 146, 399
Fsp4HI GCNGC 2 cut(s) 146, 399
FspBI CTAG 2 cut(s) 27, 381
GlaI GCGC 1 cut(s) 231
GluI GCNGC 2 cut(s) 146, 399
HaeIII GGCC 1 cut(s) 342
HhaI GCGC 1 cut(s) 232
Hin1II CATG 2 cut(s) 397, 415
Hin6I GCGC 1 cut(s) 230
HinP1I GCGC 1 cut(s) 230
HphI GGTGA 1 cut(s) 411
Hpy188I TCNGA 3 cut(s) 105, 115, 163
HpyAV CCTTC 1 cut(s) 26
HpyCH4III ACNGT 2 cut(s) 43, 89
HpyCH4V TGCA 6 cut(s) 119, 179, 254, 293, 401, 415
HpyF10VI GCNNNNNNNGC 1 cut(s) 145
HpyF3I CTNAG 1 cut(s) 318
Hsp92II CATG 2 cut(s) 397, 415
HspAI GCGC 1 cut(s) 230
Kzo9I GATC 1 cut(s) 216
Lsp1109I GCAGC 2 cut(s) 157, 385
LweI GCATC 2 cut(s) 106, 280
MaeI CTAG 2 cut(s) 27, 381
MalI GATC 1 cut(s) 218
MboI GATC 1 cut(s) 216
MboII GAAGA 1 cut(s) 77
MfeI CAATTG 1 cut(s) 255
MluCI AATT 2 cut(s) 255, 330
MmeI TCCRAC 1 cut(s) 128
MnlI CCTC 5 cut(s) 61, 111, 178, 277, 432
Mph1103I ATGCAT 1 cut(s) 417
MseI TTAA 3 cut(s) 75, 129, 234
MspR9I CCNGG 3 cut(s) 9, 141, 339
MunI CAATTG 1 cut(s) 255
Mva1269I GAATGC 1 cut(s) 415
MvaI CCWGG 3 cut(s) 9, 141, 339
MwoI GCNNNNNNNGC 1 cut(s) 145
NdeII GATC 1 cut(s) 216
NlaIII CATG 2 cut(s) 397, 415
NsiI ATGCAT 1 cut(s) 417
PctI GAATGC 1 cut(s) 415
PflFI GACNNNGTC 1 cut(s) 109
PkrI GCNGC 2 cut(s) 147, 400
PshBI ATTAAT 1 cut(s) 129
Psp6I CCWGG 3 cut(s) 7, 139, 337
PspGI CCWGG 3 cut(s) 7, 139, 337
PspPI GGNCC 1 cut(s) 11
PsyI GACNNNGTC 1 cut(s) 109
SaqAI TTAA 3 cut(s) 75, 129, 234
SatI GCNGC 2 cut(s) 146, 399
Sau3AI GATC 1 cut(s) 216
Sau96I GGNCC 1 cut(s) 11
ScrFI CCNGG 3 cut(s) 9, 141, 339
SetI ASST 9 cut(s) 16, 72, 150, 189, 210, 246, 288, 407, 424
SfaNI GCATC 2 cut(s) 106, 280
SfcI CTRYAG 1 cut(s) 212
SinI GGWCC 1 cut(s) 11
Sse9I AATT 2 cut(s) 255, 330
SspMI CTAG 2 cut(s) 27, 381
StyD4I CCNGG 3 cut(s) 7, 139, 337
TaaI ACNGT 2 cut(s) 43, 89
TasI AATT 2 cut(s) 255, 330
Tru1I TTAA 3 cut(s) 75, 129, 234
Tru9I TTAA 3 cut(s) 75, 129, 234
TseI GCWGC 2 cut(s) 145, 398
TspDTI ATGAA 2 cut(s) 382, 400
Tth111I GACNNNGTC 1 cut(s) 109
VpaK11BI GGWCC 1 cut(s) 11
VspI ATTAAT 1 cut(s) 129
XspI CTAG 2 cut(s) 27, 381
Zsp2I ATGCAT 1 cut(s) 417
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.