Rmu_sc0001354.1_g000005

histone-lysine N-methyltransferase, H3 lysine-9 specific

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001354.1
OG0002400
Physical Location & Seq
Reverse (-)
13478 .. 14668
1191 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1191 bp
atggtgcaaagtagtgaaagtgaagatcacaattctctacttgatcgtgatttggttaaatcatccaaaaatctccagcaaggtaagagaaattatgggatttcgcatttttctattacggctacaccacgagaaattttgccctcaccacagagtgtattgaaaagtaactctgtaaagagcaaggaggatcggaacactaacctatcaatccaccaaggattgaggaagcgacaacctttgtctgatgaatatcgacctgaaaggacggctgtatgtggaaattttgattttagtcaccagcatgtgcataatttggaagataatgataataccgaggtgaagaaggatcttgatgtgatcgaagatactttggtcaaatccaagaaacaaaattggagcaacgaatatcagcacaaaatcaacacagtgtccaaaaatgttgttacaactttcaattcaaaaaatagtcatttcgtcttagcgagaaagagacaaccactgtgggaccaccagcaaccttaccagacgagtatgcatgcggagtttactagtcaaaaatcggtggaagtggaacataaaaatcgtaacaaggtcaagggggctttggaagcctatagagagatattgactaagtctgaggcacaaaactgtaattggagttacattaaagtagcaatggatctcaaaaaacaaggaaaatgggttaacaagatgaagcaagtaggatcgattgcaggagtacaagttggtgataggtttcgacatagagctcaactaaccattgttggtcttcatcgacaatttacatgtggtattgattatatgtggaggaaggacggaaaaattttggccacaagtattgttgattctggtcgctatgttaacaatttgcaatcttctgatatactgatctactctggtcaaggtggaaagtctccgtttcataaaactaaaccgacagatcaaataatgcaaggtggaaaccttgcattaaggaatagcaaagaagaaggaactcctgtaagggtaattcgaaggttgaaacattctaagggttcgtgttatgtttactatggattatacaccgtagaaagagttctgcaagaaagacaacttggtattatgatctataaatttacgttgagaaggaagtcgggacaaccagagctttcatttgacagtaattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00310 ko04211 map00310 map04211
Pfam Domains
Protein Families
Pre-SET SAD_SRA SET

Protein Analysis

396

Amino Acids

45.55

Weight (kDa)

9.72

Isoelectric Point (pI)

47.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SAD_SRA PF02182 242 - 388 2.7e-41 SAD/SRA domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 542
AclWI GGATC 4 cut(s) 198, 357, 690, 736
AcoI YGGCCR 1 cut(s) 852
AcsI RAATTY 4 cut(s) 135, 283, 846, 1136
AdeI CACNNNGTG 1 cut(s) 155
AfaI GTAC 1 cut(s) 744
AflIII ACRYGT 1 cut(s) 809
AgsI TTSAA 4 cut(s) 163, 457, 462, 1045
AhlI ACTAGT 1 cut(s) 551
AjuI GAANNNNNNNTTGG 2 cut(s) 1101, 1133
AluBI AGCT 2 cut(s) 773, 1171
AluI AGCT 2 cut(s) 773, 1171
Alw21I GWGCWC 1 cut(s) 775
Alw26I GTCTC 2 cut(s) 487, 942
AlwI GGATC 4 cut(s) 198, 357, 690, 736
AoxI GGCC 1 cut(s) 852
ApoI RAATTY 4 cut(s) 135, 283, 846, 1136
Asp700I GAANNNNTTC 1 cut(s) 1098
AspS9I GGNCC 1 cut(s) 508
AsuHPI GGTGA 4 cut(s) 138, 290, 352, 764
AsuII TTCGAA 1 cut(s) 1036
AvaII GGWCC 1 cut(s) 508
BaeI ACNNNNGTAYC 2 cut(s) 360, 393
BalI TGGCCA 1 cut(s) 854
BanII GRGCYC 1 cut(s) 775
BauI CACGAG 1 cut(s) 129
BbsI GAAGAC 1 cut(s) 785
Bbv12I GWGCWC 1 cut(s) 775
BceAI ACGGC 2 cut(s) 135, 285
BcoDI GTCTC 2 cut(s) 487, 942
BcuI ACTAGT 1 cut(s) 551
BfaI CTAG 1 cut(s) 552
BfmI CTRYAG 1 cut(s) 616
Bme18I GGWCC 1 cut(s) 508
BmgT120I GGNCC 1 cut(s) 508
BmiI GGNNCC 1 cut(s) 509
BpiI GAAGAC 1 cut(s) 785
BpmI CTGGAG 1 cut(s) 59
Bpu14I TTCGAA 1 cut(s) 1036
Bsa29I ATCGAT 1 cut(s) 731
BsaBI GATNNNNATC 1 cut(s) 252
BsaJI CCNNGG 2 cut(s) 217, 336
BsaXI ACNNNNNCTCC 2 cut(s) 732, 762
Bse3DI GCAATG 1 cut(s) 684
Bse8I GATNNNNATC 1 cut(s) 252
BseCI ATCGAT 1 cut(s) 731
BseDI CCNNGG 2 cut(s) 217, 336
BseGI GGATG 1 cut(s) 62
BseJI GATNNNNATC 1 cut(s) 252
BseMI GCAATG 1 cut(s) 684
BseMII CTCAG 1 cut(s) 630
BshFI GGCC 1 cut(s) 854
BshVI ATCGAT 1 cut(s) 731
BsiHKAI GWGCWC 1 cut(s) 775
BslFI GGGAC 2 cut(s) 521, 1173
BsmAI GTCTC 2 cut(s) 487, 942
BsmFI GGGAC 2 cut(s) 521, 1173
BsnI GGCC 1 cut(s) 854
Bsp119I TTCGAA 1 cut(s) 1036
Bsp1286I GDGCHC 1 cut(s) 775
BspACI CCGC 1 cut(s) 542
BspANI GGCC 1 cut(s) 854
BspCNI CTCAG 1 cut(s) 631
BspDI ATCGAT 1 cut(s) 731
BspLI GGNNCC 1 cut(s) 509
BspPI GGATC 4 cut(s) 198, 357, 690, 736
BspT104I TTCGAA 1 cut(s) 1036
BsrDI GCAATG 1 cut(s) 684
BssECI CCNNGG 2 cut(s) 217, 336
BssSI CACGAG 1 cut(s) 129
BssT1I CCWWGG 1 cut(s) 217
Bst2BI CACGAG 1 cut(s) 129
Bst4CI ACNGT 5 cut(s) 430, 504, 653, 1090, 1184
BstBI TTCGAA 1 cut(s) 1036
BstC8I GCNNGC 1 cut(s) 540
BstDEI CTNAG 4 cut(s) 481, 633, 639, 1053
BstF5I GGATG 1 cut(s) 62
BstMAI GTCTC 2 cut(s) 487, 942
BstMWI GCNNNNNNNGC 1 cut(s) 611
BstNSI RCATGY 3 cut(s) 308, 542, 813
BstSFI CTRYAG 1 cut(s) 616
BstV2I GAAGAC 1 cut(s) 785
BstX2I RGATCY 2 cut(s) 349, 682
BstYI RGATCY 2 cut(s) 349, 682
Bsu15I ATCGAT 1 cut(s) 731
BsuRI GGCC 1 cut(s) 854
BsuTUI ATCGAT 1 cut(s) 731
BtsCI GGATG 1 cut(s) 62
BtsIMutI CAGTG 2 cut(s) 435, 500
Cac8I GCNNGC 1 cut(s) 540
Cfr13I GGNCC 1 cut(s) 508
ClaI ATCGAT 1 cut(s) 731
Csp6I GTAC 1 cut(s) 743
CspCI CAANNNNNGTGG 4 cut(s) 485, 520, 844, 879
CviAII CATG 3 cut(s) 305, 539, 810
CviJI RGCY 7 cut(s) 122, 272, 605, 614, 773, 854, 1171
CviKI_1 RGCY 7 cut(s) 122, 272, 605, 614, 773, 854, 1171
CviQI GTAC 1 cut(s) 743
DdeI CTNAG 4 cut(s) 481, 633, 639, 1053
DraIII CACNNNGTG 1 cut(s) 155
EaeI YGGCCR 1 cut(s) 852
Ecl136II GAGCTC 1 cut(s) 773
Eco130I CCWWGG 1 cut(s) 217
Eco24I GRGCYC 1 cut(s) 775
Eco47I GGWCC 1 cut(s) 508
Eco53kI GAGCTC 1 cut(s) 773
EcoICRI GAGCTC 1 cut(s) 773
EcoT14I CCWWGG 1 cut(s) 217
EcoT22I ATGCAT 1 cut(s) 540
EcoT38I GRGCYC 1 cut(s) 775
ErhI CCWWGG 1 cut(s) 217
FaeI CATG 3 cut(s) 308, 542, 813
FaqI GGGAC 2 cut(s) 521, 1173
FatI CATG 3 cut(s) 304, 538, 809
FokI GGATG 1 cut(s) 49
FriOI GRGCYC 1 cut(s) 775
FspBI CTAG 1 cut(s) 552
GsuI CTGGAG 1 cut(s) 59
HaeIII GGCC 1 cut(s) 854
Hin1II CATG 3 cut(s) 308, 542, 813
HincII GTYRAC 2 cut(s) 709, 886
HindII GTYRAC 2 cut(s) 709, 886
HinfI GANTC 1 cut(s) 869
HpaI GTTAAC 2 cut(s) 709, 886
HphI GGTGA 4 cut(s) 138, 290, 352, 764
Hpy166II GTNNAC 4 cut(s) 549, 709, 886, 1072
Hpy188I TCNGA 4 cut(s) 195, 247, 640, 904
Hpy188III TCNNGA 3 cut(s) 47, 353, 1158
Hpy8I GTNNAC 4 cut(s) 549, 709, 886, 1072
HpyAV CCTTC 5 cut(s) 340, 829, 1007, 1032, 1143
HpyCH4III ACNGT 5 cut(s) 430, 504, 653, 1090, 1184
HpyCH4IV ACGT 1 cut(s) 1142
HpyCH4V TGCA 8 cut(s) 7, 310, 538, 737, 895, 976, 992, 1105
HpyF10VI GCNNNNNNNGC 1 cut(s) 611
HpyF3I CTNAG 4 cut(s) 481, 633, 639, 1053
HpySE526I ACGT 1 cut(s) 1142
Hsp92II CATG 3 cut(s) 308, 542, 813
KspAI GTTAAC 2 cut(s) 709, 886
LmnI GCTCC 1 cut(s) 399
MaeI CTAG 1 cut(s) 552
MaeII ACGT 1 cut(s) 1142
MaeIII GTNAC 5 cut(s) 167, 296, 445, 587, 662
MboII GAAGA 7 cut(s) 35, 332, 355, 377, 785, 891, 1022
MflI RGATCY 2 cut(s) 349, 682
MhlI GDGCHC 1 cut(s) 775
MlsI TGGCCA 1 cut(s) 854
MluNI TGGCCA 1 cut(s) 854
MnlI CCTC 6 cut(s) 154, 181, 219, 331, 634, 825
Mox20I TGGCCA 1 cut(s) 854
Mph1103I ATGCAT 1 cut(s) 540
MroXI GAANNNNTTC 1 cut(s) 1098
MscI TGGCCA 1 cut(s) 854
MseI TTAA 5 cut(s) 57, 669, 708, 885, 995
MslI CAYNNNNRTG 1 cut(s) 303
Msp20I TGGCCA 1 cut(s) 854
MwoI GCNNNNNNNGC 1 cut(s) 611
NlaIII CATG 3 cut(s) 308, 542, 813
NlaIV GGNNCC 1 cut(s) 509
NmuCI GTSAC 1 cut(s) 296
NsiI ATGCAT 1 cut(s) 540
NspI RCATGY 3 cut(s) 308, 542, 813
NspV TTCGAA 1 cut(s) 1036
PaeI GCATGC 1 cut(s) 542
PciI ACATGT 1 cut(s) 809
PdmI GAANNNNTTC 1 cut(s) 1098
PfeI GAWTC 1 cut(s) 869
PflFI GACNNNGTC 1 cut(s) 634
PscI ACATGT 1 cut(s) 809
Psp124BI GAGCTC 1 cut(s) 775
PspN4I GGNNCC 1 cut(s) 509
PspPI GGNCC 1 cut(s) 508
PsrI GAACNNNNNNTAC 2 cut(s) 1083, 1115
PsuI RGATCY 2 cut(s) 349, 682
PsyI GACNNNGTC 1 cut(s) 634
RsaI GTAC 1 cut(s) 744
RsaNI GTAC 1 cut(s) 743
RseI CAYNNNNRTG 1 cut(s) 303
SacI GAGCTC 1 cut(s) 775
SaqAI TTAA 5 cut(s) 57, 669, 708, 885, 995
Sau96I GGNCC 1 cut(s) 508
SduI GDGCHC 1 cut(s) 775
SfcI CTRYAG 1 cut(s) 616
SfuI TTCGAA 1 cut(s) 1036
SinI GGWCC 1 cut(s) 508
SmiMI CAYNNNNRTG 1 cut(s) 303
SpeI ACTAGT 1 cut(s) 551
SphI GCATGC 1 cut(s) 542
SsiI CCGC 1 cut(s) 542
SspMI CTAG 1 cut(s) 552
SstI GAGCTC 1 cut(s) 775
StyI CCWWGG 1 cut(s) 217
TaaI ACNGT 5 cut(s) 430, 504, 653, 1090, 1184
TaiI ACGT 1 cut(s) 1145
TaqI TCGA 6 cut(s) 256, 363, 731, 763, 799, 1036
TatI WGTACW 1 cut(s) 742
TfiI GAWTC 1 cut(s) 869
Tru1I TTAA 5 cut(s) 57, 669, 708, 885, 995
Tru9I TTAA 5 cut(s) 57, 669, 708, 885, 995
TscAI CASTG 2 cut(s) 435, 507
TseFI GTSAC 1 cut(s) 296
Tsp45I GTSAC 1 cut(s) 296
TspDTI ATGAA 5 cut(s) 264, 731, 785, 935, 1164
TspGWI ACGGA 2 cut(s) 855, 930
TspRI CASTG 2 cut(s) 435, 507
Tth111I GACNNNGTC 1 cut(s) 634
VpaK11BI GGWCC 1 cut(s) 508
XapI RAATTY 4 cut(s) 135, 283, 846, 1136
XceI RCATGY 3 cut(s) 308, 542, 813
XmnI GAANNNNTTC 1 cut(s) 1098
XspI CTAG 1 cut(s) 552
Zsp2I ATGCAT 1 cut(s) 540
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.