Rmu_sc0002064.1_g000008

Acts as a Mg(2 ) transporter. Can also transport other divalent cations such as Fe(2 ), Sr(2 ), Ba(2 ), Mn(2 ) and Co(2 ) but to a much less extent than Mg(2 )

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002064.1
Physical Location & Seq
Reverse (-)
42602 .. 43648
1047 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002064.1_g000008.1.cds

Sequence Viewer

Length: 330 bp
atgttcatgaattcttcgtttcaggctttggataccttcagtgcaactattgttgctccagtatattatgtgatgttcacaactctgaccattattgctagtgtaataatgttcaaggattggtctggtcaggatgtgagcagcatagcctctgaaatttgtggattcattactgtactgtcaggaaccattatactccatgctaccagagatcaggaaccacctcctccacaaggaactgtaacatggtacattagtggagattcaatgaaggcttcagaagatgaagatttgattgctttacacaattcagattttcttgaaccgtaa

Protein Analysis

109

Amino Acids

11.97

Weight (kDa)

4.05

Isoelectric Point (pI)

39.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 10, 156
AcuI CTGAAG 2 cut(s) 22, 261
AfaI GTAC 2 cut(s) 177, 251
AfiI CCNNNNNNNGG 1 cut(s) 233
AgsI TTSAA 3 cut(s) 115, 267, 323
ApeKI GCWGC 1 cut(s) 141
ApoI RAATTY 2 cut(s) 10, 156
BaeI ACNNNNGTAYC 2 cut(s) 241, 274
BbvI GCAGC 1 cut(s) 153
BciVI GTATCC 1 cut(s) 25
BfaI CTAG 1 cut(s) 99
BfuI GTATCC 1 cut(s) 25
BisI GCNGC 1 cut(s) 142
BlsI GCNGC 1 cut(s) 143
BmiI GGNNCC 2 cut(s) 187, 219
BpmI CTGGAG 1 cut(s) 42
Bsc4I CCNNNNNNNGG 1 cut(s) 233
Bse1I ACTGG 1 cut(s) 59
BseGI GGATG 1 cut(s) 139
BseLI CCNNNNNNNGG 1 cut(s) 233
BseNI ACTGG 1 cut(s) 59
BseRI GAGGAG 1 cut(s) 216
BseXI GCAGC 1 cut(s) 153
BslI CCNNNNNNNGG 1 cut(s) 233
Bsp143I GATC 1 cut(s) 211
BspHI TCATGA 1 cut(s) 6
BspLI GGNNCC 2 cut(s) 187, 219
BsrI ACTGG 1 cut(s) 59
BssMI GATC 1 cut(s) 211
Bst4CI ACNGT 4 cut(s) 175, 180, 241, 327
BstENI CCTNNNNNAGG 1 cut(s) 231
BstF5I GGATG 1 cut(s) 139
BstKTI GATC 1 cut(s) 214
BstMBI GATC 1 cut(s) 211
BstV1I GCAGC 1 cut(s) 153
BsuI GTATCC 1 cut(s) 25
BtsCI GGATG 1 cut(s) 139
BtsIMutI CAGTG 1 cut(s) 46
CciI TCATGA 1 cut(s) 6
Csp6I GTAC 2 cut(s) 176, 250
CviAII CATG 3 cut(s) 7, 200, 246
CviJI RGCY 3 cut(s) 26, 149, 275
CviKI_1 RGCY 3 cut(s) 26, 149, 275
CviQI GTAC 2 cut(s) 176, 250
DpnI GATC 1 cut(s) 213
DpnII GATC 1 cut(s) 211
Eco57I CTGAAG 2 cut(s) 22, 261
EcoNI CCTNNNNNAGG 1 cut(s) 231
EcoRI GAATTC 1 cut(s) 10
FaeI CATG 3 cut(s) 10, 203, 249
FaiI YATR 7 cut(s) 8, 64, 69, 146, 194, 201, 247
FatI CATG 3 cut(s) 6, 199, 245
Fnu4HI GCNGC 1 cut(s) 142
FokI GGATG 1 cut(s) 146
Fsp4HI GCNGC 1 cut(s) 142
FspBI CTAG 1 cut(s) 99
GluI GCNGC 1 cut(s) 142
GsuI CTGGAG 1 cut(s) 42
Hin1II CATG 3 cut(s) 10, 203, 249
HinfI GANTC 2 cut(s) 165, 263
Hpy166II GTNNAC 1 cut(s) 78
Hpy188I TCNGA 4 cut(s) 87, 154, 280, 313
Hpy188III TCNNGA 5 cut(s) 7, 131, 183, 215, 320
Hpy8I GTNNAC 1 cut(s) 78
HpyAV CCTTC 2 cut(s) 46, 265
HpyCH4III ACNGT 4 cut(s) 175, 180, 241, 327
HpyCH4V TGCA 1 cut(s) 44
Hsp92II CATG 3 cut(s) 10, 203, 249
Kzo9I GATC 1 cut(s) 211
LmnI GCTCC 1 cut(s) 61
LpnPI CCDG 7 cut(s) 8, 72, 111, 116, 168, 200, 220
Lsp1109I GCAGC 1 cut(s) 153
MaeI CTAG 1 cut(s) 99
MaeIII GTNAC 1 cut(s) 241
MalI GATC 1 cut(s) 213
MboI GATC 1 cut(s) 211
MboII GAAGA 3 cut(s) 6, 293, 299
MluCI AATT 3 cut(s) 10, 156, 307
MnlI CCTC 3 cut(s) 160, 234, 237
NdeII GATC 1 cut(s) 211
NlaIII CATG 3 cut(s) 10, 203, 249
NlaIV GGNNCC 2 cut(s) 187, 219
PagI TCATGA 1 cut(s) 6
PfeI GAWTC 2 cut(s) 165, 263
PkrI GCNGC 1 cut(s) 143
PspN4I GGNNCC 2 cut(s) 187, 219
RsaI GTAC 2 cut(s) 177, 251
RsaNI GTAC 2 cut(s) 176, 250
SatI GCNGC 1 cut(s) 142
Sau3AI GATC 1 cut(s) 211
SetI ASST 2 cut(s) 38, 226
Sse9I AATT 3 cut(s) 10, 156, 307
SspMI CTAG 1 cut(s) 99
TaaI ACNGT 4 cut(s) 175, 180, 241, 327
TasI AATT 3 cut(s) 10, 156, 307
TatI WGTACW 1 cut(s) 175
TfiI GAWTC 2 cut(s) 165, 263
TscAI CASTG 1 cut(s) 46
TseI GCWGC 1 cut(s) 141
TspDTI ATGAA 4 cut(s) 23, 157, 284, 300
TspRI CASTG 1 cut(s) 46
XagI CCTNNNNNAGG 1 cut(s) 231
XapI RAATTY 2 cut(s) 10, 156
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.