Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003862.1

Orthogroup ID

OG0004523

Physical Location & Seq

Genomic Coordinates Reverse (-)

140856 .. 141416

Gene Structure 561 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003862.1_g000021.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 561 bp

atggaggaagttggaagtgatggaacattgcagacatttgaacttaatgaggagggtcataaaagagtgtacattgttcgatttaattcttcaaatctgaccatctcttgtagttatcagatgtatgaatctatgggctggttatgctgtcatgctttgagggtgttaaatgtgaaaaatattactcaaataccaacatcgtatatactaaagagatggacaaaagatgcaaagaaaggagtagaggcaaatagtgtaccactacaggtcaaggagaaatcaatggtgacattgcgtaggaatactttaatgcgaaaagcttatggtataattagtaagggagcagaaacaactagtggtagtgatatcgcgatgcaaaaattgatagaagcagaagagctaattgagaggaatatgaagaagttatctattatgggagatgtcaatgaaaaaatcaatgaggttcctagtgttaatctggtggcagtgctaacaaaaatgaaaccttatttgatgaaacaccagtactcaatccagcaggtgtgtggccaaaaggcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

FAR1 MULE PEARLI-4 SWIM

Protein Analysis

186

Amino Acids

21.11

Weight (kDa)

9.21

Isoelectric Point (pI)

44.59

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004523)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g19192 FvH4_2g28081 FvH4_3g38531 FvH4_4g08901 FvH4_4g10602 FvH4_5g08846 FvH4_5g35621 FvH4_5g39268 FvH4_6g16341 FvH4_6g16871
prunus_persica	Prupe.1G223100_v2.0.a1
pyrus_communis	pycom13g15010
rosa_multiflora	Rmu_sc0000685.1_g000016 Rmu_sc0001531.1_g000026 Rmu_sc0002147.1_g000003 Rmu_sc0002902.1_g000036 Rmu_sc0003862.1_g000021 Rmu_sc0003862.1_g000022 Rmu_sc0004821.1_g000010 Rmu_sc0014091.1_g000001
rosa_roxburghii	Rroxscaffold_1G00027570
rosa_rugosa	Rorug05G0276000
rosa_wichuraiana	Rw1G006610 Rw2G015080 Rw2G044360 Rw3G015500 Rw3G025940 Rw4G003790 Rw5G035860 Rw7G029410 Rw7G029850 Rw7G029900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	529
Acc36I	ACCTGC	1 cut(s)	529
AccII	CGCG	1 cut(s)	371
AcoI	YGGCCR	1 cut(s)	547
AfaI	GTAC	3 cut(s)	71, 258, 527
AgsI	TTSAA	2 cut(s)	41, 93
AhlI	ACTAGT	1 cut(s)	353
AluBI	AGCT	2 cut(s)	320, 400
AluI	AGCT	2 cut(s)	320, 400
AoxI	GGCC	1 cut(s)	547
AsuHPI	GGTGA	1 cut(s)	298
BalI	TGGCCA	1 cut(s)	549
BccI	CCATC	3 cut(s)	14, 110, 210
BcuI	ACTAGT	1 cut(s)	353
BfaI	CTAG	2 cut(s)	354, 468
BfmI	CTRYAG	1 cut(s)	263
BfuAI	ACCTGC	1 cut(s)	529
BmcAI	AGTACT	1 cut(s)	527
BmiI	GGNNCC	1 cut(s)	465
BmsI	GCATC	2 cut(s)	217, 363
Bse1I	ACTGG	1 cut(s)	523
Bse3DI	GCAATG	2 cut(s)	26, 290
BseMI	GCAATG	2 cut(s)	26, 290
BseNI	ACTGG	1 cut(s)	523
BseRI	GAGGAG	1 cut(s)	65
Bsh1236I	CGCG	1 cut(s)	371
BshFI	GGCC	1 cut(s)	549
BsnI	GGCC	1 cut(s)	549
Bsp1407I	TGTACA	1 cut(s)	69
Bsp68I	TCGCGA	1 cut(s)	371
BspANI	GGCC	1 cut(s)	549
BspFNI	CGCG	1 cut(s)	371
BspLI	GGNNCC	1 cut(s)	465
BspMI	ACCTGC	1 cut(s)	529
BspQI	GCTCTTC	1 cut(s)	390
BsrDI	GCAATG	2 cut(s)	26, 290
BsrGI	TGTACA	1 cut(s)	69
BsrI	ACTGG	1 cut(s)	523
Bst6I	CTCTTC	1 cut(s)	390
BstAUI	TGTACA	1 cut(s)	69
BstFNI	CGCG	1 cut(s)	371
BstMWI	GCNNNNNNNGC	1 cut(s)	144
BstSFI	CTRYAG	1 cut(s)	263
BstUI	CGCG	1 cut(s)	371
BsuRI	GGCC	1 cut(s)	549
BtgZI	GCGATG	1 cut(s)	386
BtsI	GCAGTG	1 cut(s)	492
BtsIMutI	CAGTG	1 cut(s)	492
BtuMI	TCGCGA	1 cut(s)	371
BveI	ACCTGC	1 cut(s)	529
Csp6I	GTAC	3 cut(s)	70, 257, 526
CviAII	CATG	1 cut(s)	152
CviJI	RGCY	5 cut(s)	138, 320, 400, 549, 557
CviKI_1	RGCY	5 cut(s)	138, 320, 400, 549, 557
CviQI	GTAC	3 cut(s)	70, 257, 526
EaeI	YGGCCR	1 cut(s)	547
Eam1104I	CTCTTC	1 cut(s)	390
EarI	CTCTTC	1 cut(s)	390
Eco32I	GATATC	1 cut(s)	367
EcoRV	GATATC	1 cut(s)	367
FaeI	CATG	1 cut(s)	155
FatI	CATG	1 cut(s)	151
FspBI	CTAG	2 cut(s)	354, 468
HaeIII	GGCC	1 cut(s)	549
Hin1II	CATG	1 cut(s)	155
HindIII	AAGCTT	1 cut(s)	318
HinfI	GANTC	1 cut(s)	128
HphI	GGTGA	1 cut(s)	298
Hpy166II	GTNNAC	2 cut(s)	70, 257
Hpy188I	TCNGA	2 cut(s)	99, 120
Hpy188III	TCNNGA	1 cut(s)	370
Hpy8I	GTNNAC	2 cut(s)	70, 257
HpyCH4V	TGCA	3 cut(s)	31, 230, 376
HpyF10VI	GCNNNNNNNGC	1 cut(s)	144
Hsp92II	CATG	1 cut(s)	155
LguI	GCTCTTC	1 cut(s)	390
LmnI	GCTCC	1 cut(s)	341
LpnPI	CCDG	6 cut(s)	124, 251, 464, 524, 536, 548
LweI	GCATC	2 cut(s)	217, 363
MaeI	CTAG	2 cut(s)	354, 468
MaeIII	GTNAC	1 cut(s)	286
MboII	GAAGA	3 cut(s)	81, 407, 430
MlsI	TGGCCA	1 cut(s)	549
MluCI	AATT	4 cut(s)	85, 330, 380, 402
MluNI	TGGCCA	1 cut(s)	549
MnlI	CCTC	6 cut(s)	43, 46, 153, 238, 402, 454
Mox20I	TGGCCA	1 cut(s)	549
MscI	TGGCCA	1 cut(s)	549
MseI	TTAA	5 cut(s)	45, 84, 167, 308, 474
Msp20I	TGGCCA	1 cut(s)	549
MvnI	CGCG	1 cut(s)	371
MwoI	GCNNNNNNNGC	1 cut(s)	144
NlaIII	CATG	1 cut(s)	155
NlaIV	GGNNCC	1 cut(s)	465
NmuCI	GTSAC	1 cut(s)	286
NruI	TCGCGA	1 cut(s)	371
PaqCI	CACCTGC	1 cut(s)	529
PciSI	GCTCTTC	1 cut(s)	390
PfeI	GAWTC	1 cut(s)	128
PspN4I	GGNNCC	1 cut(s)	465
RruI	TCGCGA	1 cut(s)	371
RsaI	GTAC	3 cut(s)	71, 258, 527
RsaNI	GTAC	3 cut(s)	70, 257, 526
SapI	GCTCTTC	1 cut(s)	390
SaqAI	TTAA	5 cut(s)	45, 84, 167, 308, 474
ScaI	AGTACT	1 cut(s)	527
SetI	ASST	6 cut(s)	270, 322, 402, 465, 508, 543
SfaNI	GCATC	2 cut(s)	217, 363
SfcI	CTRYAG	1 cut(s)	263
SpeI	ACTAGT	1 cut(s)	353
Sse9I	AATT	4 cut(s)	85, 330, 380, 402
SspI	AATATT	1 cut(s)	181
SspMI	CTAG	2 cut(s)	354, 468
TaqI	TCGA	1 cut(s)	79
TasI	AATT	4 cut(s)	85, 330, 380, 402
TatI	WGTACW	2 cut(s)	69, 525
TfiI	GAWTC	1 cut(s)	128
Tru1I	TTAA	5 cut(s)	45, 84, 167, 308, 474
Tru9I	TTAA	5 cut(s)	45, 84, 167, 308, 474
TscAI	CASTG	1 cut(s)	492
TseFI	GTSAC	1 cut(s)	286
Tsp45I	GTSAC	1 cut(s)	286
TspDTI	ATGAA	5 cut(s)	141, 431, 462, 515, 530
TspRI	CASTG	1 cut(s)	492
XcmI	CCANNNNNNNNNTGG	1 cut(s)	542
XspI	CTAG	2 cut(s)	354, 468
ZrmI	AGTACT	1 cut(s)	527

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.