Rorug05G0276000

protein FAR1-RELATED SEQUENCE

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
31160384 .. 31160548
165 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0276000.1

Sequence Viewer

Length: 165 bp
ATGTTTCCCATATTTTCAAGGAGGGGAATGCTCCGGCAGACGTTTTGGCTAACTATGGCGCGTCCCATGAGGGCGCGCTCTCATAATTGGACTTCGTTGCCTCAATTCTTGGTTCCCACATTTGGTCGTGACTTCTCGTCTCTGCCAGCCTACAGGTTCTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

6.5

Weight (kDa)

12.0

Isoelectric Point (pI)

66.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 61, 76
AfiI CCNNNNNNNGG 1 cut(s) 122
AgsI TTSAA 1 cut(s) 18
AhdI GACNNNNNGTC 1 cut(s) 136
Alw26I GTCTC 1 cut(s) 144
AspLEI GCGC 3 cut(s) 61, 76, 78
BcoDI GTCTC 1 cut(s) 144
BfmI CTRYAG 1 cut(s) 151
BmeRI GACNNNNNGTC 1 cut(s) 136
BmiI GGNNCC 1 cut(s) 114
Bsc4I CCNNNNNNNGG 1 cut(s) 122
BseLI CCNNNNNNNGG 1 cut(s) 122
BsePI GCGCGC 1 cut(s) 74
Bsh1236I CGCG 2 cut(s) 61, 76
BsiSI CCGG 1 cut(s) 34
BslFI GGGAC 1 cut(s) 48
BslI CCNNNNNNNGG 1 cut(s) 122
BsmAI GTCTC 1 cut(s) 144
BsmBI CGTCTC 1 cut(s) 144
BsmFI GGGAC 1 cut(s) 48
BsmI GAATGC 1 cut(s) 33
BspFNI CGCG 2 cut(s) 61, 76
BspLI GGNNCC 1 cut(s) 114
BssHII GCGCGC 1 cut(s) 74
BstC8I GCNNGC 2 cut(s) 76, 147
BstFNI CGCG 2 cut(s) 61, 76
BstHHI GCGC 3 cut(s) 61, 76, 78
BstMAI GTCTC 1 cut(s) 144
BstSFI CTRYAG 1 cut(s) 151
BstUI CGCG 2 cut(s) 61, 76
Cac8I GCNNGC 2 cut(s) 76, 147
CfoI GCGC 3 cut(s) 61, 76, 78
CseI GACGC 1 cut(s) 50
CviAII CATG 1 cut(s) 67
CviJI RGCY 2 cut(s) 49, 149
CviKI_1 RGCY 2 cut(s) 49, 149
DriI GACNNNNNGTC 1 cut(s) 136
Eam1105I GACNNNNNGTC 1 cut(s) 136
Esp3I CGTCTC 1 cut(s) 144
FaeI CATG 1 cut(s) 70
FaiI YATR 4 cut(s) 11, 56, 68, 84
FaqI GGGAC 1 cut(s) 48
FatI CATG 1 cut(s) 66
GlaI GCGC 3 cut(s) 60, 75, 77
HapII CCGG 1 cut(s) 34
HgaI GACGC 1 cut(s) 50
HhaI GCGC 3 cut(s) 61, 76, 78
Hin1II CATG 1 cut(s) 70
Hin6I GCGC 3 cut(s) 59, 74, 76
HinP1I GCGC 3 cut(s) 59, 74, 76
HpaII CCGG 1 cut(s) 34
Hpy188III TCNNGA 1 cut(s) 128
HpyCH4IV ACGT 1 cut(s) 41
HpySE526I ACGT 1 cut(s) 41
Hsp92II CATG 1 cut(s) 70
HspAI GCGC 3 cut(s) 59, 74, 76
LmnI GCTCC 1 cut(s) 36
LpnPI CCDG 3 cut(s) 47, 139, 159
MaeII ACGT 1 cut(s) 41
MaeIII GTNAC 1 cut(s) 128
MluCI AATT 2 cut(s) 85, 104
MnlI CCTC 3 cut(s) 15, 63, 111
MseI TTAA 1 cut(s) 163
MspI CCGG 1 cut(s) 34
Mva1269I GAATGC 1 cut(s) 33
MvnI CGCG 2 cut(s) 61, 76
NlaIII CATG 1 cut(s) 70
NlaIV GGNNCC 1 cut(s) 114
NmuCI GTSAC 1 cut(s) 128
PauI GCGCGC 1 cut(s) 74
PctI GAATGC 1 cut(s) 33
PspN4I GGNNCC 1 cut(s) 114
PteI GCGCGC 1 cut(s) 74
SaqAI TTAA 1 cut(s) 163
SetI ASST 2 cut(s) 44, 158
SfcI CTRYAG 1 cut(s) 151
SgeI CNNG 9 cut(s) 30, 46, 72, 79, 87, 121, 140, 148, 158
Sse9I AATT 2 cut(s) 85, 104
TaiI ACGT 1 cut(s) 44
TasI AATT 2 cut(s) 85, 104
Tru1I TTAA 1 cut(s) 163
Tru9I TTAA 1 cut(s) 163
TseFI GTSAC 1 cut(s) 128
Tsp45I GTSAC 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.