Rmu_sc0005322.1_g000013

Tudor-like domain present in plant sequences.

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005322.1
OG0000683
Physical Location & Seq
Forward (+)
40684 .. 41052
369 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005322.1_g000013.1.cds

Sequence Viewer

Length: 369 bp
atggtccaatctttgggtgatggaagtagggatgtccaagctattgctggtgtcaagcaacctttaacaggaaaggagacaccagctacagaaacaaatatggagtctgatgtgtcagatagtgggtttgagagaatgagttgcccagatactgtttcaaaattgcatgttaaagatgcatcaaatgaaatggaggcaactacaattagggtagacatacttgataacaaaaagcccttaaagagaaagaaaactcatgtggcagatagtggcttggttgagaaggcaagtagagttcctttatcttttgcattatctgtgacttttcacaataatatttatcgatggcacgcaattcctaatgtttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Agenet

Protein Analysis

122

Amino Acids

13.39

Weight (kDa)

6.9

Isoelectric Point (pI)

45.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 13
AccI GTMKAC 1 cut(s) 213
AfiI CCNNNNNNNGG 2 cut(s) 13, 68
AgsI TTSAA 1 cut(s) 159
AluBI AGCT 2 cut(s) 41, 86
AluI AGCT 2 cut(s) 41, 86
Alw26I GTCTC 1 cut(s) 71
AlwNI CAGNNNCTG 1 cut(s) 152
ArsI GACNNNNNNTTYG 2 cut(s) 89, 121
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 29
AvaII GGWCC 1 cut(s) 4
BccI CCATC 2 cut(s) 14, 339
BcoDI GTCTC 1 cut(s) 71
BfmI CTRYAG 1 cut(s) 87
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmsI GCATC 2 cut(s) 166, 188
Bsa29I ATCGAT 1 cut(s) 343
Bsc4I CCNNNNNNNGG 2 cut(s) 13, 68
BseCI ATCGAT 1 cut(s) 343
BseGI GGATG 1 cut(s) 37
BseLI CCNNNNNNNGG 2 cut(s) 13, 68
BshVI ATCGAT 1 cut(s) 343
BslI CCNNNNNNNGG 2 cut(s) 13, 68
BsmAI GTCTC 1 cut(s) 71
BspDI ATCGAT 1 cut(s) 343
Bst4CI ACNGT 1 cut(s) 154
BstC8I GCNNGC 1 cut(s) 351
BstENI CCTNNNNNAGG 1 cut(s) 66
BstF5I GGATG 1 cut(s) 37
BstMAI GTCTC 1 cut(s) 71
BstNSI RCATGY 1 cut(s) 170
BstSFI CTRYAG 1 cut(s) 87
Bsu15I ATCGAT 1 cut(s) 343
BsuTUI ATCGAT 1 cut(s) 343
BtsCI GGATG 1 cut(s) 37
Cac8I GCNNGC 1 cut(s) 351
CaiI CAGNNNCTG 1 cut(s) 152
Cfr13I GGNCC 1 cut(s) 4
ClaI ATCGAT 1 cut(s) 343
CviAII CATG 2 cut(s) 167, 257
CviJI RGCY 4 cut(s) 41, 86, 235, 273
CviKI_1 RGCY 4 cut(s) 41, 86, 235, 273
Eco47I GGWCC 1 cut(s) 4
EcoNI CCTNNNNNAGG 1 cut(s) 66
EcoT22I ATGCAT 1 cut(s) 181
FaeI CATG 2 cut(s) 170, 260
FaiI YATR 4 cut(s) 101, 168, 218, 258
FatI CATG 2 cut(s) 166, 256
FblI GTMKAC 1 cut(s) 213
FokI GGATG 1 cut(s) 44
Hin1II CATG 2 cut(s) 170, 260
HinfI GANTC 1 cut(s) 104
HphI GGTGA 1 cut(s) 29
Hpy166II GTNNAC 1 cut(s) 214
Hpy188I TCNGA 2 cut(s) 109, 118
Hpy8I GTNNAC 1 cut(s) 214
HpyAV CCTTC 1 cut(s) 277
HpyCH4III ACNGT 1 cut(s) 154
HpyCH4V TGCA 3 cut(s) 166, 179, 311
Hsp92II CATG 2 cut(s) 170, 260
LpnPI CCDG 4 cut(s) 33, 54, 96, 159
LweI GCATC 2 cut(s) 166, 188
MaeIII GTNAC 1 cut(s) 319
MluCI AATT 3 cut(s) 161, 204, 354
MlyI GAGTC 1 cut(s) 113
MnlI CCTC 1 cut(s) 187
Mph1103I ATGCAT 1 cut(s) 181
MseI TTAA 4 cut(s) 65, 171, 239, 367
NlaIII CATG 2 cut(s) 170, 260
NmuCI GTSAC 1 cut(s) 319
NsiI ATGCAT 1 cut(s) 181
NspI RCATGY 1 cut(s) 170
PflMI CCANNNNNTGG 1 cut(s) 13
PleI GAGTC 1 cut(s) 112
PpsI GAGTC 1 cut(s) 112
PspPI GGNCC 1 cut(s) 4
PstNI CAGNNNCTG 1 cut(s) 152
SaqAI TTAA 4 cut(s) 65, 171, 239, 367
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 1 cut(s) 113
SetI ASST 3 cut(s) 43, 64, 88
SfaNI GCATC 2 cut(s) 166, 188
SfcI CTRYAG 1 cut(s) 87
SinI GGWCC 1 cut(s) 4
Sse9I AATT 3 cut(s) 161, 204, 354
SspI AATATT 1 cut(s) 337
TaaI ACNGT 1 cut(s) 154
TaqI TCGA 1 cut(s) 343
TasI AATT 3 cut(s) 161, 204, 354
Tru1I TTAA 4 cut(s) 65, 171, 239, 367
Tru9I TTAA 4 cut(s) 65, 171, 239, 367
TseFI GTSAC 1 cut(s) 319
Tsp45I GTSAC 1 cut(s) 319
TspDTI ATGAA 1 cut(s) 201
Van91I CCANNNNNTGG 1 cut(s) 13
VpaK11BI GGWCC 1 cut(s) 4
XagI CCTNNNNNAGG 1 cut(s) 66
XceI RCATGY 1 cut(s) 170
XcmI CCANNNNNNNNNTGG 1 cut(s) 44
XmiI GTMKAC 1 cut(s) 213
Zsp2I ATGCAT 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.