Rmu_sc0008713.1_g000025

Angio-associated migratory cell

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008713.1
OG0001404
Physical Location & Seq
Forward (+)
64473 .. 67634
3162 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008713.1_g000025.1.cds

Sequence Viewer

Length: 804 bp
atgagcaatccaggtcatgttgttcatgaagaagaagatgatgaccaaggcgaggtttacattgatgaagctgacatccttaatgaagtcgatttcgatgaggaagatcttccagatgcagacgaccaagttgttgatgagcctgatgattccatgcatacatttactggtcatacgggtgaactttatacagttgtctgcagtccgacagatccagtgttagttgcaacagggggtggagatgacagagggtttctttggaagattggacaaggagattgggcttctgaggtccaaggccataaggattctgtttctagtttagcatttagtactgatggacagttgcttgcatctggaagcttggatggaattattcaaatttgggatataacatcagcaaatctaaaaagcactcttgaaggtcctggagggggcattgagtttggatgtggaatgcgacaaaggttcctatattcaattgtttcagggcatggtggtagcgtgacttgtggtgattttacccccgatggtaaaacaatctgcactggttctaatgatgcaagtttgagaatatggaacccaaaaagtggagagaacattcatgtggtacaaggtcatccttaccattctgcagggttgacatgcttggcaataagctctgattcaactctagctgttactggttctgaagatggctctgtccatattgtaaatataactactggaaaggttgttagttccctggcttcacattcagattcagtagaatgtatcggacttccaccgtctctccacaattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
WD40

Protein Analysis

267

Amino Acids

28.1

Weight (kDa)

4.19

Isoelectric Point (pI)

38.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 590
AclWI GGATC 1 cut(s) 206
AcsI RAATTY 1 cut(s) 381
AcuI CTGAAG 1 cut(s) 711
AfaI GTAC 2 cut(s) 334, 612
AfiI CCNNNNNNNGG 3 cut(s) 52, 434, 590
AgsI TTSAA 4 cut(s) 380, 422, 480, 669
AjnI CCWGG 3 cut(s) 10, 427, 744
AluBI AGCT 4 cut(s) 71, 363, 660, 677
AluI AGCT 4 cut(s) 71, 363, 660, 677
Alw26I GTCTC 1 cut(s) 795
AlwI GGATC 1 cut(s) 206
AoxI GGCC 1 cut(s) 298
ApoI RAATTY 1 cut(s) 381
Asp700I GAANNNNTTC 1 cut(s) 108
AspS9I GGNCC 2 cut(s) 292, 425
AsuHPI GGTGA 2 cut(s) 191, 527
AvaII GGWCC 2 cut(s) 292, 425
BccI CCATC 4 cut(s) 332, 362, 524, 689
BciT130I CCWGG 3 cut(s) 12, 429, 746
BcoDI GTCTC 1 cut(s) 795
BfaI CTAG 2 cut(s) 318, 674
BfmI CTRYAG 2 cut(s) 199, 633
BglII AGATCT 1 cut(s) 106
BmcAI AGTACT 1 cut(s) 334
Bme1390I CCNGG 3 cut(s) 12, 429, 746
Bme18I GGWCC 2 cut(s) 292, 425
BmgT120I GGNCC 2 cut(s) 292, 425
BmiI GGNNCC 2 cut(s) 470, 581
BmrFI CCNGG 3 cut(s) 12, 429, 746
BmsI GCATC 3 cut(s) 106, 362, 550
BpmI CTGGAG 1 cut(s) 450
BsaJI CCNNGG 3 cut(s) 46, 295, 744
BsaXI ACNNNNNCTCC 1 cut(s) 777
Bsc4I CCNNNNNNNGG 3 cut(s) 52, 434, 590
Bse1I ACTGG 5 cut(s) 172, 215, 553, 688, 730
BseBI CCWGG 3 cut(s) 12, 429, 746
BseDI CCNNGG 3 cut(s) 46, 295, 744
BseGI GGATG 4 cut(s) 75, 373, 455, 619
BseLI CCNNNNNNNGG 3 cut(s) 52, 434, 590
BseMII CTCAG 1 cut(s) 279
BseNI ACTGG 5 cut(s) 172, 215, 553, 688, 730
BsgI GTGCAG 1 cut(s) 529
BshFI GGCC 1 cut(s) 300
BslI CCNNNNNNNGG 3 cut(s) 52, 434, 590
BsmAI GTCTC 1 cut(s) 795
BsmBI CGTCTC 1 cut(s) 795
BsmI GAATGC 1 cut(s) 462
BsnI GGCC 1 cut(s) 300
Bsp143I GATC 2 cut(s) 106, 211
BspANI GGCC 1 cut(s) 300
BspCNI CTCAG 1 cut(s) 280
BspHI TCATGA 1 cut(s) 25
BspLI GGNNCC 2 cut(s) 470, 581
BspMAI CTGCAG 2 cut(s) 203, 637
BspPI GGATC 1 cut(s) 206
BsrI ACTGG 5 cut(s) 172, 215, 553, 688, 730
BssECI CCNNGG 3 cut(s) 46, 295, 744
BssMI GATC 2 cut(s) 106, 211
BssT1I CCWWGG 2 cut(s) 46, 295
Bst2UI CCWGG 3 cut(s) 12, 429, 746
Bst4CI ACNGT 3 cut(s) 193, 345, 789
BstC8I GCNNGC 1 cut(s) 351
BstDEI CTNAG 1 cut(s) 288
BstF5I GGATG 4 cut(s) 75, 373, 455, 619
BstKTI GATC 2 cut(s) 109, 214
BstMAI GTCTC 1 cut(s) 795
BstMBI GATC 2 cut(s) 106, 211
BstNI CCWGG 3 cut(s) 12, 429, 746
BstNSI RCATGY 1 cut(s) 648
BstSCI CCNGG 3 cut(s) 10, 427, 744
BstSFI CTRYAG 2 cut(s) 199, 633
BstX2I RGATCY 2 cut(s) 106, 211
BstYI RGATCY 2 cut(s) 106, 211
BsuRI GGCC 1 cut(s) 300
BtsCI GGATG 4 cut(s) 75, 373, 455, 619
BtsIMutI CAGTG 2 cut(s) 222, 546
Cac8I GCNNGC 1 cut(s) 351
CciI TCATGA 1 cut(s) 25
Cfr13I GGNCC 2 cut(s) 292, 425
Csp6I GTAC 2 cut(s) 333, 611
CviAII CATG 6 cut(s) 17, 26, 154, 494, 605, 645
CviJI RGCY 9 cut(s) 71, 142, 284, 300, 363, 660, 677, 699, 749
CviKI_1 RGCY 9 cut(s) 71, 142, 284, 300, 363, 660, 677, 699, 749
CviQI GTAC 2 cut(s) 333, 611
DdeI CTNAG 1 cut(s) 288
DpnI GATC 2 cut(s) 108, 213
DpnII GATC 2 cut(s) 106, 211
Eco130I CCWWGG 2 cut(s) 46, 295
Eco47I GGWCC 2 cut(s) 292, 425
Eco57I CTGAAG 1 cut(s) 711
EcoO109I RGGNCCY 1 cut(s) 425
EcoRII CCWGG 3 cut(s) 10, 427, 744
EcoT14I CCWWGG 2 cut(s) 46, 295
EcoT22I ATGCAT 1 cut(s) 159
ErhI CCWWGG 2 cut(s) 46, 295
Esp3I CGTCTC 1 cut(s) 795
FaeI CATG 6 cut(s) 20, 29, 157, 497, 608, 648
FatI CATG 6 cut(s) 16, 25, 153, 493, 604, 644
FokI GGATG 4 cut(s) 62, 380, 462, 606
FspBI CTAG 2 cut(s) 318, 674
GsuI CTGGAG 1 cut(s) 450
HaeIII GGCC 1 cut(s) 300
Hin1II CATG 6 cut(s) 20, 29, 157, 497, 608, 648
HincII GTYRAC 1 cut(s) 642
HindII GTYRAC 1 cut(s) 642
HindIII AAGCTT 1 cut(s) 361
HinfI GANTC 4 cut(s) 149, 308, 665, 761
HphI GGTGA 2 cut(s) 191, 527
Hpy166II GTNNAC 3 cut(s) 58, 182, 642
Hpy188I TCNGA 6 cut(s) 207, 289, 664, 691, 760, 779
Hpy188III TCNNGA 4 cut(s) 26, 113, 357, 419
Hpy8I GTNNAC 3 cut(s) 58, 182, 642
HpyAV CCTTC 1 cut(s) 416
HpyCH4III ACNGT 3 cut(s) 193, 345, 789
HpyCH4V TGCA 8 cut(s) 119, 157, 201, 227, 353, 546, 563, 635
HpyF3I CTNAG 1 cut(s) 288
Hsp92II CATG 6 cut(s) 20, 29, 157, 497, 608, 648
Kzo9I GATC 2 cut(s) 106, 211
LweI GCATC 3 cut(s) 106, 362, 550
MaeI CTAG 2 cut(s) 318, 674
MaeIII GTNAC 2 cut(s) 505, 679
MalI GATC 2 cut(s) 108, 213
MboI GATC 2 cut(s) 106, 211
MboII GAAGA 7 cut(s) 41, 44, 47, 101, 116, 274, 704
MfeI CAATTG 2 cut(s) 480, 799
MflI RGATCY 2 cut(s) 106, 211
MluCI AATT 4 cut(s) 372, 381, 480, 799
MmeI TCCRAC 1 cut(s) 230
MnlI CCTC 5 cut(s) 46, 94, 242, 283, 425
Mph1103I ATGCAT 1 cut(s) 159
MroXI GAANNNNTTC 1 cut(s) 108
MseI TTAA 1 cut(s) 81
MslI CAYNNNNRTG 2 cut(s) 177, 605
MspR9I CCNGG 3 cut(s) 12, 429, 746
MunI CAATTG 2 cut(s) 480, 799
Mva1269I GAATGC 1 cut(s) 462
MvaI CCWGG 3 cut(s) 12, 429, 746
NdeII GATC 2 cut(s) 106, 211
NlaIII CATG 6 cut(s) 20, 29, 157, 497, 608, 648
NlaIV GGNNCC 2 cut(s) 470, 581
NmuCI GTSAC 1 cut(s) 505
NsiI ATGCAT 1 cut(s) 159
NspI RCATGY 1 cut(s) 648
PagI TCATGA 1 cut(s) 25
PctI GAATGC 1 cut(s) 462
PdmI GAANNNNTTC 1 cut(s) 108
PfeI GAWTC 4 cut(s) 149, 308, 665, 761
PflMI CCANNNNNTGG 1 cut(s) 590
PfoI TCCNGGA 1 cut(s) 427
PpuMI RGGWCCY 1 cut(s) 425
Psp5II RGGWCCY 1 cut(s) 425
Psp6I CCWGG 3 cut(s) 10, 427, 744
PspGI CCWGG 3 cut(s) 10, 427, 744
PspN4I GGNNCC 2 cut(s) 470, 581
PspPI GGNCC 2 cut(s) 292, 425
PspPPI RGGWCCY 1 cut(s) 425
PstI CTGCAG 2 cut(s) 203, 637
PsuI RGATCY 2 cut(s) 106, 211
RsaI GTAC 2 cut(s) 334, 612
RsaNI GTAC 2 cut(s) 333, 611
RseI CAYNNNNRTG 2 cut(s) 177, 605
SaqAI TTAA 1 cut(s) 81
Sau3AI GATC 2 cut(s) 106, 211
Sau96I GGNCC 2 cut(s) 292, 425
ScaI AGTACT 1 cut(s) 334
ScrFI CCNGG 3 cut(s) 12, 429, 746
SfaNI GCATC 3 cut(s) 106, 362, 550
SfcI CTRYAG 2 cut(s) 199, 633
SinI GGWCC 2 cut(s) 292, 425
SmiMI CAYNNNNRTG 2 cut(s) 177, 605
Sse9I AATT 4 cut(s) 372, 381, 480, 799
SspMI CTAG 2 cut(s) 318, 674
StyD4I CCNGG 3 cut(s) 10, 427, 744
StyI CCWWGG 2 cut(s) 46, 295
TaaI ACNGT 3 cut(s) 193, 345, 789
TaqI TCGA 2 cut(s) 90, 96
TasI AATT 4 cut(s) 372, 381, 480, 799
TatI WGTACW 1 cut(s) 332
TfiI GAWTC 4 cut(s) 149, 308, 665, 761
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TscAI CASTG 2 cut(s) 222, 553
TseFI GTSAC 1 cut(s) 505
Tsp45I GTSAC 1 cut(s) 505
TspDTI ATGAA 5 cut(s) 14, 42, 81, 99, 593
TspRI CASTG 2 cut(s) 222, 553
Van91I CCANNNNNTGG 1 cut(s) 590
VpaK11BI GGWCC 2 cut(s) 292, 425
XapI RAATTY 1 cut(s) 381
XceI RCATGY 1 cut(s) 648
XmnI GAANNNNTTC 1 cut(s) 108
XspI CTAG 2 cut(s) 318, 674
ZrmI AGTACT 1 cut(s) 334
Zsp2I ATGCAT 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.