Rmu_sc0011509.1_g000001

GDSL esterase lipase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011509.1
Physical Location & Seq
Forward (+)
614 .. 2109
1496 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011509.1_g000001.1.cds

Sequence Viewer

Length: 522 bp
atggggcctcatccatctgggctaggacctcatgtaccacttcctgagtatattgagaacatgaggaaaattgcaaatcatctccagagcctttcagattcaacacgcatcgtttttcttagttgtcctcctgtgaatgaggccacagttcgtgaaaataaaagtccttatctcagcgagttaataagaacgaatgagctatgccaacaatattccgaagcttgtataaagctatgccaggaactggatatcaaggtggttgatctttttacggcaatacagaaaggagaaaactgttttacagatgggattcatttatcagctgaagggagcaaaatagttgcggaggagatactgaaagtactgagagaagctgattggaagccaagtttacactggaaatccatgccaacagaatttgcagaggattcaccatatgatcttgttgctgctgatggaaagacgacgttaaatccctccgaatggacgttttatagagattttcactggaactctctataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

173

Amino Acids

19.62

Weight (kDa)

5.1

Isoelectric Point (pI)

45.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 244
AciI CCGC 1 cut(s) 344
AcsI RAATTY 1 cut(s) 416
AcuI CTGAAG 1 cut(s) 345
AfaI GTAC 2 cut(s) 36, 363
AfiI CCNNNNNNNGG 2 cut(s) 244, 483
AgsI TTSAA 1 cut(s) 102
AjnI CCWGG 1 cut(s) 237
AluBI AGCT 5 cut(s) 199, 221, 232, 323, 374
AluI AGCT 5 cut(s) 199, 221, 232, 323, 374
AlwNI CAGNNNCTG 1 cut(s) 244
AoxI GGCC 2 cut(s) 5, 141
ApeKI GCWGC 1 cut(s) 449
ApoI RAATTY 1 cut(s) 416
AspS9I GGNCC 2 cut(s) 5, 26
AsuHPI GGTGA 1 cut(s) 423
AvaII GGWCC 1 cut(s) 26
BbvI GCAGC 1 cut(s) 436
BccI CCATC 3 cut(s) 22, 299, 449
BceAI ACGGC 1 cut(s) 288
BciT130I CCWGG 1 cut(s) 239
BfaI CTAG 1 cut(s) 23
BisI GCNGC 1 cut(s) 450
BlsI GCNGC 1 cut(s) 451
BmcAI AGTACT 1 cut(s) 363
Bme1390I CCNGG 1 cut(s) 239
Bme18I GGWCC 1 cut(s) 26
BmgT120I GGNCC 2 cut(s) 5, 26
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 239
BmsI GCATC 1 cut(s) 117
BpmI CTGGAG 1 cut(s) 68
Bsc4I CCNNNNNNNGG 2 cut(s) 244, 483
Bse1I ACTGG 3 cut(s) 249, 401, 512
BseBI CCWGG 1 cut(s) 239
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 2 cut(s) 244, 483
BseMII CTCAG 3 cut(s) 36, 187, 356
BseNI ACTGG 3 cut(s) 249, 401, 512
BseRI GAGGAG 1 cut(s) 362
BseXI GCAGC 1 cut(s) 436
BshFI GGCC 2 cut(s) 7, 143
BslI CCNNNNNNNGG 2 cut(s) 244, 483
BsnI GGCC 2 cut(s) 7, 143
Bsp143I GATC 2 cut(s) 262, 439
BspACI CCGC 1 cut(s) 344
BspANI GGCC 2 cut(s) 7, 143
BspCNI CTCAG 3 cut(s) 37, 186, 357
BspLI GGNNCC 1 cut(s) 6
BsrI ACTGG 3 cut(s) 249, 401, 512
BssMI GATC 2 cut(s) 262, 439
Bst2UI CCWGG 1 cut(s) 239
Bst4CI ACNGT 2 cut(s) 148, 296
BstDEI CTNAG 4 cut(s) 45, 119, 173, 365
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 2 cut(s) 265, 442
BstMBI GATC 2 cut(s) 262, 439
BstNI CCWGG 1 cut(s) 239
BstSCI CCNGG 1 cut(s) 237
BstV1I GCAGC 1 cut(s) 436
BsuRI GGCC 2 cut(s) 7, 143
BtsCI GGATG 1 cut(s) 10
BtsIMutI CAGTG 2 cut(s) 394, 505
CaiI CAGNNNCTG 1 cut(s) 244
Cfr13I GGNCC 2 cut(s) 5, 26
Csp6I GTAC 2 cut(s) 35, 362
CviAII CATG 3 cut(s) 32, 61, 406
CviQI GTAC 2 cut(s) 35, 362
DdeI CTNAG 4 cut(s) 45, 119, 173, 365
DpnI GATC 2 cut(s) 264, 441
DpnII GATC 2 cut(s) 262, 439
Eco32I GATATC 1 cut(s) 250
Eco47I GGWCC 1 cut(s) 26
Eco57I CTGAAG 1 cut(s) 345
EcoO109I RGGNCCY 2 cut(s) 5, 26
EcoRII CCWGG 1 cut(s) 237
EcoRV GATATC 1 cut(s) 250
FaeI CATG 3 cut(s) 35, 64, 409
FatI CATG 3 cut(s) 31, 60, 405
FauNDI CATATG 1 cut(s) 436
Fnu4HI GCNGC 1 cut(s) 450
Fsp4HI GCNGC 1 cut(s) 450
FspBI CTAG 1 cut(s) 23
GluI GCNGC 1 cut(s) 450
GsuI CTGGAG 1 cut(s) 68
HaeIII GGCC 2 cut(s) 7, 143
Hin1II CATG 3 cut(s) 35, 64, 409
HindIII AAGCTT 1 cut(s) 219
HinfI GANTC 3 cut(s) 98, 310, 428
HphI GGTGA 1 cut(s) 423
Hpy166II GTNNAC 1 cut(s) 392
Hpy188I TCNGA 3 cut(s) 97, 217, 481
Hpy188III TCNNGA 3 cut(s) 44, 85, 152
Hpy8I GTNNAC 1 cut(s) 392
Hpy99I CGWCG 1 cut(s) 469
HpyAV CCTTC 1 cut(s) 320
HpyCH4III ACNGT 2 cut(s) 148, 296
HpyCH4IV ACGT 2 cut(s) 467, 488
HpyCH4V TGCA 2 cut(s) 74, 422
HpyF3I CTNAG 4 cut(s) 45, 119, 173, 365
HpySE526I ACGT 2 cut(s) 467, 488
Hsp92II CATG 3 cut(s) 35, 64, 409
Kzo9I GATC 2 cut(s) 262, 439
LmnI GCTCC 1 cut(s) 330
LpnPI CCDG 9 cut(s) 3, 57, 98, 144, 224, 230, 251, 382, 493
Lsp1109I GCAGC 1 cut(s) 436
LweI GCATC 1 cut(s) 117
MaeI CTAG 1 cut(s) 23
MaeII ACGT 2 cut(s) 467, 488
MalI GATC 2 cut(s) 264, 441
MboI GATC 2 cut(s) 262, 439
MluCI AATT 2 cut(s) 69, 416
MnlI CCTC 8 cut(s) 18, 39, 57, 133, 138, 340, 418, 487
MseI TTAA 2 cut(s) 182, 470
MspA1I CMGCKG 1 cut(s) 323
MspR9I CCNGG 1 cut(s) 239
MvaI CCWGG 1 cut(s) 239
NdeI CATATG 1 cut(s) 436
NdeII GATC 2 cut(s) 262, 439
NlaIII CATG 3 cut(s) 35, 64, 409
NlaIV GGNNCC 1 cut(s) 6
PfeI GAWTC 3 cut(s) 98, 310, 428
PflMI CCANNNNNTGG 1 cut(s) 244
PkrI GCNGC 1 cut(s) 451
PpuMI RGGWCCY 1 cut(s) 26
Psp5II RGGWCCY 1 cut(s) 26
Psp6I CCWGG 1 cut(s) 237
PspGI CCWGG 1 cut(s) 237
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 2 cut(s) 5, 26
PspPPI RGGWCCY 1 cut(s) 26
PstNI CAGNNNCTG 1 cut(s) 244
PvuII CAGCTG 1 cut(s) 323
RsaI GTAC 2 cut(s) 36, 363
RsaNI GTAC 2 cut(s) 35, 362
SaqAI TTAA 2 cut(s) 182, 470
SatI GCNGC 1 cut(s) 450
Sau3AI GATC 2 cut(s) 262, 439
Sau96I GGNCC 2 cut(s) 5, 26
ScaI AGTACT 1 cut(s) 363
ScrFI CCNGG 1 cut(s) 239
SetI ASST 9 cut(s) 31, 201, 223, 234, 258, 325, 376, 470, 491
SfaNI GCATC 1 cut(s) 117
SinI GGWCC 1 cut(s) 26
Sse9I AATT 2 cut(s) 69, 416
SsiI CCGC 1 cut(s) 344
SspI AATATT 1 cut(s) 212
SspMI CTAG 1 cut(s) 23
StyD4I CCNGG 1 cut(s) 237
TaaI ACNGT 2 cut(s) 148, 296
TaiI ACGT 2 cut(s) 470, 491
TasI AATT 2 cut(s) 69, 416
TatI WGTACW 1 cut(s) 361
TfiI GAWTC 3 cut(s) 98, 310, 428
Tru1I TTAA 2 cut(s) 182, 470
Tru9I TTAA 2 cut(s) 182, 470
TscAI CASTG 2 cut(s) 401, 512
TseI GCWGC 1 cut(s) 449
TspDTI ATGAA 1 cut(s) 302
TspRI CASTG 2 cut(s) 401, 512
Van91I CCANNNNNTGG 1 cut(s) 244
VpaK11BI GGWCC 1 cut(s) 26
XapI RAATTY 1 cut(s) 416
XcmI CCANNNNNNNNNTGG 1 cut(s) 393
XspI CTAG 1 cut(s) 23
ZrmI AGTACT 1 cut(s) 363
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.