Rmu_sc0014417.1_g000008

2,3-bisphosphoglycerate-independent phosphoglycerate

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014417.1
Physical Location & Seq
Reverse (-)
28443 .. 28840
398 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014417.1_g000008.1.cds

Sequence Viewer

Length: 249 bp
atggggaagagaaataagatcgggcaacctcttcttgacaagagtggcaacatcgaaatccttacctcccacactcttcaaccagttcccattgctattggaggccctggactggcacctggtgttaagttccgcaaggatcttccgagtggtggtcttgccaatgttgctgcaactatgatcaatctgcttggatttgaggcccctgctgactatgagccgtccctcattgaagttgttgataactag

Protein Analysis

82

Amino Acids

8.55

Weight (kDa)

5.64

Isoelectric Point (pI)

62.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 115
AciI CCGC 1 cut(s) 133
AclWI GGATC 1 cut(s) 147
AdeI CACNNNGTG 1 cut(s) 122
AfiI CCNNNNNNNGG 2 cut(s) 112, 152
AgsI TTSAA 2 cut(s) 80, 233
AjnI CCWGG 2 cut(s) 106, 118
AlwI GGATC 1 cut(s) 147
AoxI GGCC 2 cut(s) 103, 201
ApeKI GCWGC 1 cut(s) 170
AspS9I GGNCC 2 cut(s) 104, 202
BanI GGYRCC 1 cut(s) 115
BbvI GCAGC 1 cut(s) 157
BceAI ACGGC 1 cut(s) 205
BciT130I CCWGG 2 cut(s) 108, 120
BclI TGATCA 1 cut(s) 180
BfaI CTAG 1 cut(s) 247
BisI GCNGC 1 cut(s) 171
BlsI GCNGC 1 cut(s) 172
Bme1390I CCNGG 2 cut(s) 108, 120
BmgT120I GGNCC 2 cut(s) 104, 202
BmiI GGNNCC 2 cut(s) 117, 204
BmrFI CCNGG 2 cut(s) 108, 120
BsaJI CCNNGG 1 cut(s) 106
Bsc4I CCNNNNNNNGG 2 cut(s) 112, 152
Bse1I ACTGG 2 cut(s) 83, 117
Bse3DI GCAATG 1 cut(s) 90
BseBI CCWGG 2 cut(s) 108, 120
BseDI CCNNGG 1 cut(s) 106
BseLI CCNNNNNNNGG 2 cut(s) 112, 152
BseMI GCAATG 1 cut(s) 90
BseNI ACTGG 2 cut(s) 83, 117
BseXI GCAGC 1 cut(s) 157
BshFI GGCC 2 cut(s) 105, 203
BshNI GGYRCC 1 cut(s) 115
BslFI GGGAC 1 cut(s) 208
BslI CCNNNNNNNGG 2 cut(s) 112, 152
BsmFI GGGAC 1 cut(s) 208
BsnI GGCC 2 cut(s) 105, 203
Bsp143I GATC 3 cut(s) 18, 139, 180
BspACI CCGC 1 cut(s) 133
BspANI GGCC 2 cut(s) 105, 203
BspLI GGNNCC 2 cut(s) 117, 204
BspPI GGATC 1 cut(s) 147
BspT107I GGYRCC 1 cut(s) 115
BsrDI GCAATG 1 cut(s) 90
BsrI ACTGG 2 cut(s) 83, 117
BssECI CCNNGG 1 cut(s) 106
BssMI GATC 3 cut(s) 18, 139, 180
Bst2UI CCWGG 2 cut(s) 108, 120
Bst6I CTCTTC 3 cut(s) 2, 36, 81
BstKTI GATC 3 cut(s) 21, 142, 183
BstMBI GATC 3 cut(s) 18, 139, 180
BstMWI GCNNNNNNNGC 1 cut(s) 167
BstNI CCWGG 2 cut(s) 108, 120
BstSCI CCNGG 2 cut(s) 106, 118
BstV1I GCAGC 1 cut(s) 157
BstX2I RGATCY 1 cut(s) 139
BstYI RGATCY 1 cut(s) 139
BsuRI GGCC 2 cut(s) 105, 203
Cfr13I GGNCC 2 cut(s) 104, 202
CsiI ACCWGGT 1 cut(s) 118
CviJI RGCY 3 cut(s) 105, 203, 220
CviKI_1 RGCY 3 cut(s) 105, 203, 220
DpnI GATC 3 cut(s) 20, 141, 182
DpnII GATC 3 cut(s) 18, 139, 180
DraIII CACNNNGTG 1 cut(s) 122
Eam1104I CTCTTC 3 cut(s) 2, 36, 81
EarI CTCTTC 3 cut(s) 2, 36, 81
EcoO109I RGGNCCY 2 cut(s) 104, 202
EcoRII CCWGG 2 cut(s) 106, 118
FaiI YATR 2 cut(s) 179, 216
FaqI GGGAC 1 cut(s) 208
FbaI TGATCA 1 cut(s) 180
Fnu4HI GCNGC 1 cut(s) 171
Fsp4HI GCNGC 1 cut(s) 171
FspBI CTAG 1 cut(s) 247
GluI GCNGC 1 cut(s) 171
HaeIII GGCC 2 cut(s) 105, 203
Hpy188I TCNGA 1 cut(s) 147
Hpy188III TCNNGA 1 cut(s) 35
HpyCH4V TGCA 1 cut(s) 173
HpyF10VI GCNNNNNNNGC 1 cut(s) 167
Ksp22I TGATCA 1 cut(s) 180
Kzo9I GATC 3 cut(s) 18, 139, 180
LpnPI CCDG 7 cut(s) 93, 96, 98, 105, 120, 132, 219
Lsp1109I GCAGC 1 cut(s) 157
MabI ACCWGGT 1 cut(s) 118
MaeI CTAG 1 cut(s) 247
MalI GATC 3 cut(s) 20, 141, 182
MboI GATC 3 cut(s) 18, 139, 180
MboII GAAGA 4 cut(s) 19, 23, 68, 134
MflI RGATCY 1 cut(s) 139
MnlI CCTC 5 cut(s) 39, 76, 95, 193, 236
MseI TTAA 1 cut(s) 126
MspR9I CCNGG 2 cut(s) 108, 120
MvaI CCWGG 2 cut(s) 108, 120
MwoI GCNNNNNNNGC 1 cut(s) 167
NdeII GATC 3 cut(s) 18, 139, 180
NlaIV GGNNCC 2 cut(s) 117, 204
PkrI GCNGC 1 cut(s) 172
Psp6I CCWGG 2 cut(s) 106, 118
PspGI CCWGG 2 cut(s) 106, 118
PspN4I GGNNCC 2 cut(s) 117, 204
PspPI GGNCC 2 cut(s) 104, 202
PsuI RGATCY 1 cut(s) 139
SaqAI TTAA 1 cut(s) 126
SatI GCNGC 1 cut(s) 171
Sau3AI GATC 3 cut(s) 18, 139, 180
Sau96I GGNCC 2 cut(s) 104, 202
ScrFI CCNGG 2 cut(s) 108, 120
SetI ASST 3 cut(s) 31, 68, 121
SexAI ACCWGGT 1 cut(s) 118
SsiI CCGC 1 cut(s) 133
SspMI CTAG 1 cut(s) 247
StyD4I CCNGG 2 cut(s) 106, 118
TaqI TCGA 1 cut(s) 54
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TseI GCWGC 1 cut(s) 170
XspI CTAG 1 cut(s) 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.