Rmu_sc0020268.1_g000001

Belongs to the UDP-glycosyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020268.1
OG0001004
Physical Location & Seq
Forward (+)
578 .. 1267
690 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020268.1_g000001.1.cds

Sequence Viewer

Length: 690 bp
atgataggaccaacaattccatcagttttcttggacaagcggttggaggatgacaaagactacggtcttagccttttcaagccaaatgtggagacttgcatgcaatggctggactccaggaaacctggctcagtcgtctatgcatcatttggaagcttggccaacctaagcatagagcaaactgcggaactcgcatggggtcttaagaatagcagtttcaatttcctgtgggtagtccgagaaacagaaaaggataaactccctaagaattttgtagaggagatatcagggaagggtctggtagtgagttggtgcccacagctacaagtcttggctcacaaggcagtgggatgtttcctcactcactgtggatggaattcgactctcgaagcgttgagcttgggagtaccgatggtggtattgccacactgggctgatcaaccgacgaatgcaaagtttgtggcggatgtgtggaaagtcggagttagggtgaatgtgaataagaaatctggtcttgcaacaaaagaagaaatagctgtgcgtattaaggaggtcatgaacaaggaaaaggggatgaagtttaaaaaggcttcgttgatttggaaggaattggctaaagaggctgtggatgaagggggaagctctgataagaacatcgaagaatttgtggcaaaagttctattgatctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00380 ko00966 ko01110 ko01210 map00380 map00966 map01110 map01210
Pfam Domains
Protein Families
UDPGT

Protein Analysis

229

Amino Acids

25.51

Weight (kDa)

8.25

Isoelectric Point (pI)

30.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 312
AciI CCGC 3 cut(s) 40, 185, 464
AcoI YGGCCR 1 cut(s) 159
AcsI RAATTY 3 cut(s) 268, 376, 662
AfaI GTAC 1 cut(s) 408
AflII CTTAAG 1 cut(s) 203
AgsI TTSAA 2 cut(s) 79, 220
AjnI CCWGG 2 cut(s) 116, 124
AluBI AGCT 5 cut(s) 156, 322, 399, 536, 642
AluI AGCT 5 cut(s) 156, 322, 399, 536, 642
Alw26I GTCTC 1 cut(s) 86
AoxI GGCC 1 cut(s) 159
ApoI RAATTY 3 cut(s) 268, 376, 662
AspS9I GGNCC 1 cut(s) 8
AsuHPI GGTGA 1 cut(s) 502
AvaII GGWCC 1 cut(s) 8
BaeGI GKGCMC 1 cut(s) 317
BalI TGGCCA 1 cut(s) 161
BanI GGYRCC 1 cut(s) 312
BccI CCATC 3 cut(s) 28, 366, 406
BciT130I CCWGG 2 cut(s) 118, 126
BclI TGATCA 1 cut(s) 436
BcoDI GTCTC 1 cut(s) 86
BfrI CTTAAG 1 cut(s) 203
Bme1390I CCNGG 2 cut(s) 118, 126
Bme18I GGWCC 1 cut(s) 8
BmgT120I GGNCC 1 cut(s) 8
BmiI GGNNCC 1 cut(s) 314
BmrFI CCNGG 2 cut(s) 118, 126
BmrI ACTGGG 1 cut(s) 439
BmsI GCATC 1 cut(s) 152
BmuI ACTGGG 1 cut(s) 439
BoxI GACNNNNGTC 1 cut(s) 63
BpmI CTGGAG 1 cut(s) 100
Bpu10I CCTNAGC 1 cut(s) 167
BsaXI ACNNNNNCTCC 2 cut(s) 474, 504
Bse1I ACTGG 1 cut(s) 434
Bse3DI GCAATG 1 cut(s) 110
BseBI CCWGG 2 cut(s) 118, 126
BseGI GGATG 6 cut(s) 55, 356, 377, 472, 579, 634
BseMI GCAATG 1 cut(s) 110
BseMII CTCAG 1 cut(s) 144
BseNI ACTGG 1 cut(s) 434
BseRI GAGGAG 1 cut(s) 293
BseSI GKGCMC 1 cut(s) 317
BshFI GGCC 1 cut(s) 161
BshNI GGYRCC 1 cut(s) 312
BsmAI GTCTC 1 cut(s) 86
BsmI GAATGC 1 cut(s) 454
BsnI GGCC 1 cut(s) 161
Bsp1286I GDGCHC 1 cut(s) 317
Bsp143I GATC 2 cut(s) 436, 684
BspACI CCGC 3 cut(s) 40, 185, 464
BspANI GGCC 1 cut(s) 161
BspCNI CTCAG 1 cut(s) 143
BspHI TCATGA 1 cut(s) 555
BspLI GGNNCC 1 cut(s) 314
BspT107I GGYRCC 1 cut(s) 312
BspTI CTTAAG 1 cut(s) 203
BsrDI GCAATG 1 cut(s) 110
BsrI ACTGG 1 cut(s) 434
BssMI GATC 2 cut(s) 436, 684
Bst2UI CCWGG 2 cut(s) 118, 126
Bst4CI ACNGT 2 cut(s) 65, 368
BstAFI CTTAAG 1 cut(s) 203
BstC8I GCNNGC 1 cut(s) 101
BstDEI CTNAG 4 cut(s) 68, 130, 167, 264
BstF5I GGATG 6 cut(s) 55, 356, 377, 472, 579, 634
BstKTI GATC 2 cut(s) 439, 687
BstMAI GTCTC 1 cut(s) 86
BstMBI GATC 2 cut(s) 436, 684
BstMWI GCNNNNNNNGC 3 cut(s) 191, 341, 620
BstNI CCWGG 2 cut(s) 118, 126
BstNSI RCATGY 1 cut(s) 103
BstPAI GACNNNNGTC 1 cut(s) 63
BstSCI CCNGG 2 cut(s) 116, 124
BstSLI GKGCMC 1 cut(s) 317
BsuRI GGCC 1 cut(s) 161
BtsCI GGATG 6 cut(s) 55, 356, 377, 472, 579, 634
BtsI GCAGTG 1 cut(s) 351
BtsIMutI CAGTG 3 cut(s) 351, 364, 427
Cac8I GCNNGC 1 cut(s) 101
CciI TCATGA 1 cut(s) 555
Cfr13I GGNCC 1 cut(s) 8
Csp6I GTAC 1 cut(s) 407
CspCI CAANNNNNGTGG 2 cut(s) 441, 476
CviAII CATG 3 cut(s) 100, 195, 556
CviQI GTAC 1 cut(s) 407
DdeI CTNAG 4 cut(s) 68, 130, 167, 264
DpnI GATC 2 cut(s) 438, 686
DpnII GATC 2 cut(s) 436, 684
DraI TTTAAA 1 cut(s) 583
EaeI YGGCCR 1 cut(s) 159
EciI GGCGGA 1 cut(s) 479
Eco32I GATATC 1 cut(s) 285
Eco47I GGWCC 1 cut(s) 8
EcoRI GAATTC 1 cut(s) 376
EcoRII CCWGG 2 cut(s) 116, 124
EcoRV GATATC 1 cut(s) 285
EcoT22I ATGCAT 1 cut(s) 145
FaeI CATG 3 cut(s) 103, 198, 559
FaiI YATR 5 cut(s) 101, 141, 173, 196, 557
FatI CATG 3 cut(s) 99, 194, 555
FbaI TGATCA 1 cut(s) 436
FokI GGATG 6 cut(s) 62, 363, 384, 479, 586, 641
GsuI CTGGAG 1 cut(s) 100
HaeIII GGCC 1 cut(s) 161
Hin1II CATG 3 cut(s) 103, 198, 559
HindIII AAGCTT 1 cut(s) 154
HinfI GANTC 2 cut(s) 113, 382
HphI GGTGA 1 cut(s) 502
Hpy188I TCNGA 4 cut(s) 239, 482, 646, 689
Hpy188III TCNNGA 2 cut(s) 386, 556
Hpy99I CGWCG 1 cut(s) 448
HpyAV CCTTC 3 cut(s) 286, 598, 626
HpyCH4III ACNGT 2 cut(s) 65, 368
HpyCH4V TGCA 5 cut(s) 99, 103, 143, 452, 518
HpyF10VI GCNNNNNNNGC 3 cut(s) 191, 341, 620
HpyF3I CTNAG 4 cut(s) 68, 130, 167, 264
Hsp92II CATG 3 cut(s) 103, 198, 559
Ksp22I TGATCA 1 cut(s) 436
Kzo9I GATC 2 cut(s) 436, 684
LweI GCATC 1 cut(s) 152
MalI GATC 2 cut(s) 438, 686
MboI GATC 2 cut(s) 436, 684
MboII GAAGA 2 cut(s) 539, 671
MhlI GDGCHC 1 cut(s) 317
MlsI TGGCCA 1 cut(s) 161
MluCI AATT 6 cut(s) 15, 220, 268, 376, 608, 662
MluNI TGGCCA 1 cut(s) 161
MlyI GAGTC 2 cut(s) 107, 376
MmeI TCCRAC 2 cut(s) 24, 460
MnlI CCTC 5 cut(s) 40, 271, 368, 544, 613
Mox20I TGGCCA 1 cut(s) 161
Mph1103I ATGCAT 1 cut(s) 145
MscI TGGCCA 1 cut(s) 161
MseI TTAA 3 cut(s) 204, 546, 582
Msp20I TGGCCA 1 cut(s) 161
MspCI CTTAAG 1 cut(s) 203
MspR9I CCNGG 2 cut(s) 118, 126
Mva1269I GAATGC 1 cut(s) 454
MvaI CCWGG 2 cut(s) 118, 126
MwoI GCNNNNNNNGC 3 cut(s) 191, 341, 620
NdeII GATC 2 cut(s) 436, 684
NlaIII CATG 3 cut(s) 103, 198, 559
NlaIV GGNNCC 1 cut(s) 314
NsiI ATGCAT 1 cut(s) 145
NspI RCATGY 1 cut(s) 103
PaeI GCATGC 1 cut(s) 103
PagI TCATGA 1 cut(s) 555
PctI GAATGC 1 cut(s) 454
PfoI TCCNGGA 1 cut(s) 116
PleI GAGTC 2 cut(s) 107, 376
PpsI GAGTC 2 cut(s) 107, 376
PshAI GACNNNNGTC 1 cut(s) 63
Psp6I CCWGG 2 cut(s) 116, 124
PspGI CCWGG 2 cut(s) 116, 124
PspN4I GGNNCC 1 cut(s) 314
PspPI GGNCC 1 cut(s) 8
RsaI GTAC 1 cut(s) 408
RsaNI GTAC 1 cut(s) 407
SaqAI TTAA 3 cut(s) 204, 546, 582
Sau3AI GATC 2 cut(s) 436, 684
Sau96I GGNCC 1 cut(s) 8
SchI GAGTC 2 cut(s) 107, 376
ScrFI CCNGG 2 cut(s) 118, 126
SduI GDGCHC 1 cut(s) 317
SetI ASST 8 cut(s) 127, 158, 168, 324, 401, 538, 555, 644
SfaNI GCATC 1 cut(s) 152
SinI GGWCC 1 cut(s) 8
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
SphI GCATGC 1 cut(s) 103
Sse9I AATT 6 cut(s) 15, 220, 268, 376, 608, 662
SsiI CCGC 3 cut(s) 40, 185, 464
StyD4I CCNGG 2 cut(s) 116, 124
TaaI ACNGT 2 cut(s) 65, 368
TaqI TCGA 3 cut(s) 380, 387, 657
TasI AATT 6 cut(s) 15, 220, 268, 376, 608, 662
Tru1I TTAA 3 cut(s) 204, 546, 582
Tru9I TTAA 3 cut(s) 204, 546, 582
TscAI CASTG 3 cut(s) 351, 371, 434
TspDTI ATGAA 3 cut(s) 572, 590, 645
TspRI CASTG 3 cut(s) 351, 371, 434
Vha464I CTTAAG 1 cut(s) 203
VpaK11BI GGWCC 1 cut(s) 8
XapI RAATTY 3 cut(s) 268, 376, 662
XceI RCATGY 1 cut(s) 103
Zsp2I ATGCAT 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.