Rorug01G0456600

Belongs to the UDP-glycosyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
55076937 .. 55077560
624 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0456600.1

Sequence Viewer

Length: 624 bp
ATGGCTTCATCGTCTGAGGAACCACCACAGCAGCCACAGTCAGTGAAGGACTGTCTTTACAAGACCAAGCTCATTCAATTCTTGGACCGCACTGCCCCTATCGTCCTCCAGAACGACAATGGCCCCTGCCCTCTCCTCGCCATCTGTAATGTTCTCTCCCTGAGAAACAACCTGAACTTGAGTGCAGACACTACAGAAGTCTCTCAAGAAAAGTTACTCACACTCGTTGCTGAAAGATTAATTGATTCTATTGATAATAAAGATGCTGTTGCCGATGCTATCGATCTACTCCCTCGCCTTGCAACCGGAATCAACGTCAACATAAAATTCACAAGGATAAGTGATTTTGAGTCTACTCCAGAACGTGTAATATTTGATCTGCTAGACATCCCACTATATCATGGCTGGATAGTTGATCCCGTGCTAAATGAGACTGCTAATGCAATTGGGTCCAAGTCCTATAATACTCTTATGGGGGAGCTTGTTGCACTGGAAACACAAAATATGACTGCAACACTCGGTGTGCCTTCCCCAAGCCTTTCTAAAACTAGATCTTTTGTTAAGTCTCTACATTCAGCTTCTTCTGATGAACCAAAGGTAATTAAAGCAGGAGACCGTTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

207

Amino Acids

22.67

Weight (kDa)

4.86

Isoelectric Point (pI)

38.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MINDY_DUB PF04424 20 - 169 2.1e-48 MINDY deubiquitinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 353
AciI CCGC 1 cut(s) 88
AclWI GGATC 1 cut(s) 410
AcsI RAATTY 1 cut(s) 326
AdeI CACNNNGTG 1 cut(s) 521
AflIII ACRYGT 1 cut(s) 364
AgsI TTSAA 1 cut(s) 77
AluBI AGCT 3 cut(s) 70, 481, 578
AluI AGCT 3 cut(s) 70, 481, 578
Alw26I GTCTC 4 cut(s) 205, 425, 570, 606
AlwI GGATC 1 cut(s) 410
AoxI GGCC 1 cut(s) 121
ApeKI GCWGC 1 cut(s) 31
ApoI RAATTY 1 cut(s) 326
AseI ATTAAT 1 cut(s) 239
AspS9I GGNCC 3 cut(s) 85, 122, 450
AvaII GGWCC 2 cut(s) 85, 450
BbvI GCAGC 1 cut(s) 43
BccI CCATC 1 cut(s) 149
BcoDI GTCTC 4 cut(s) 205, 425, 570, 606
BfaI CTAG 2 cut(s) 383, 549
BfmI CTRYAG 1 cut(s) 192
BglII AGATCT 1 cut(s) 551
BisI GCNGC 1 cut(s) 32
BlsI GCNGC 1 cut(s) 33
Bme18I GGWCC 2 cut(s) 85, 450
BmgT120I GGNCC 3 cut(s) 85, 122, 450
BmiI GGNNCC 3 cut(s) 21, 124, 451
BmsI GCATC 2 cut(s) 253, 265
BpmI CTGGAG 2 cut(s) 92, 342
BpuEI CTTGAG 2 cut(s) 189, 199
Bsa29I ATCGAT 1 cut(s) 282
BsaI GGTCTC 1 cut(s) 606
BsaWI WCCGGW 1 cut(s) 305
Bse1I ACTGG 1 cut(s) 495
BseCI ATCGAT 1 cut(s) 282
BseGI GGATG 1 cut(s) 387
BseMII CTCAG 2 cut(s) 6, 152
BseNI ACTGG 1 cut(s) 495
BseRI GAGGAG 1 cut(s) 125
BseXI GCAGC 1 cut(s) 43
BsgI GTGCAG 1 cut(s) 204
BshFI GGCC 1 cut(s) 123
BshVI ATCGAT 1 cut(s) 282
BsiSI CCGG 1 cut(s) 306
BsmAI GTCTC 4 cut(s) 205, 425, 570, 606
BsnI GGCC 1 cut(s) 123
Bso31I GGTCTC 1 cut(s) 606
Bsp143I GATC 4 cut(s) 283, 376, 415, 551
BspACI CCGC 1 cut(s) 88
BspANI GGCC 1 cut(s) 123
BspCNI CTCAG 2 cut(s) 7, 153
BspDI ATCGAT 1 cut(s) 282
BspLI GGNNCC 3 cut(s) 21, 124, 451
BspPI GGATC 1 cut(s) 410
BspTNI GGTCTC 1 cut(s) 606
BsrI ACTGG 1 cut(s) 495
BssMI GATC 4 cut(s) 283, 376, 415, 551
Bst4CI ACNGT 3 cut(s) 39, 53, 617
BstDEI CTNAG 2 cut(s) 15, 161
BstF5I GGATG 1 cut(s) 387
BstKTI GATC 4 cut(s) 286, 379, 418, 554
BstMAI GTCTC 4 cut(s) 205, 425, 570, 606
BstMBI GATC 4 cut(s) 283, 376, 415, 551
BstSFI CTRYAG 1 cut(s) 192
BstV1I GCAGC 1 cut(s) 43
BstX2I RGATCY 1 cut(s) 551
BstYI RGATCY 1 cut(s) 551
Bsu15I ATCGAT 1 cut(s) 282
BsuRI GGCC 1 cut(s) 123
BsuTUI ATCGAT 1 cut(s) 282
BtsCI GGATG 1 cut(s) 387
BtsI GCAGTG 1 cut(s) 90
BtsIMutI CAGTG 3 cut(s) 48, 90, 488
Cfr13I GGNCC 3 cut(s) 85, 122, 450
ClaI ATCGAT 1 cut(s) 282
CviAII CATG 1 cut(s) 401
CviJI RGCY 8 cut(s) 5, 34, 70, 123, 405, 481, 537, 578
CviKI_1 RGCY 8 cut(s) 5, 34, 70, 123, 405, 481, 537, 578
DdeI CTNAG 2 cut(s) 15, 161
DpnI GATC 4 cut(s) 285, 378, 417, 553
DpnII GATC 4 cut(s) 283, 376, 415, 551
DraIII CACNNNGTG 1 cut(s) 521
Eco31I GGTCTC 1 cut(s) 606
Eco47I GGWCC 2 cut(s) 85, 450
FaeI CATG 1 cut(s) 404
FaiI YATR 6 cut(s) 323, 397, 402, 462, 473, 506
FatI CATG 1 cut(s) 400
FblI GTMKAC 1 cut(s) 353
Fnu4HI GCNGC 1 cut(s) 32
FokI GGATG 1 cut(s) 374
Fsp4HI GCNGC 1 cut(s) 32
FspBI CTAG 2 cut(s) 383, 549
GluI GCNGC 1 cut(s) 32
GsuI CTGGAG 2 cut(s) 92, 342
HaeIII GGCC 1 cut(s) 123
HapII CCGG 1 cut(s) 306
Hin1II CATG 1 cut(s) 404
HincII GTYRAC 1 cut(s) 319
HindII GTYRAC 1 cut(s) 319
HinfI GANTC 3 cut(s) 245, 309, 350
HpaII CCGG 1 cut(s) 306
Hpy166II GTNNAC 2 cut(s) 319, 354
Hpy188I TCNGA 2 cut(s) 16, 586
Hpy188III TCNNGA 3 cut(s) 109, 206, 359
Hpy8I GTNNAC 2 cut(s) 319, 354
HpyAV CCTTC 2 cut(s) 40, 537
HpyCH4III ACNGT 3 cut(s) 39, 53, 617
HpyCH4IV ACGT 2 cut(s) 315, 364
HpyCH4V TGCA 5 cut(s) 185, 302, 443, 488, 512
HpyF3I CTNAG 2 cut(s) 15, 161
HpySE526I ACGT 2 cut(s) 315, 364
Hsp92II CATG 1 cut(s) 404
Kzo9I GATC 4 cut(s) 283, 376, 415, 551
LmnI GCTCC 1 cut(s) 478
LpnPI CCDG 9 cut(s) 122, 139, 173, 185, 319, 372, 391, 476, 594
Lsp1109I GCAGC 1 cut(s) 43
LweI GCATC 2 cut(s) 253, 265
MaeI CTAG 2 cut(s) 383, 549
MaeII ACGT 2 cut(s) 315, 364
MaeIII GTNAC 1 cut(s) 213
MalI GATC 4 cut(s) 285, 378, 417, 553
MboI GATC 4 cut(s) 283, 376, 415, 551
MboII GAAGA 1 cut(s) 573
MfeI CAATTG 1 cut(s) 444
MflI RGATCY 1 cut(s) 551
MluCI AATT 5 cut(s) 77, 240, 326, 444, 600
MlyI GAGTC 1 cut(s) 359
MnlI CCTC 5 cut(s) 10, 116, 141, 146, 303
MseI TTAA 3 cut(s) 239, 561, 603
MspI CCGG 1 cut(s) 306
MunI CAATTG 1 cut(s) 444
NdeII GATC 4 cut(s) 283, 376, 415, 551
NlaIII CATG 1 cut(s) 404
NlaIV GGNNCC 3 cut(s) 21, 124, 451
PfeI GAWTC 2 cut(s) 245, 309
PkrI GCNGC 1 cut(s) 33
PleI GAGTC 1 cut(s) 358
PpsI GAGTC 1 cut(s) 358
PshBI ATTAAT 1 cut(s) 239
PspN4I GGNNCC 3 cut(s) 21, 124, 451
PspPI GGNCC 3 cut(s) 85, 122, 450
PsuI RGATCY 1 cut(s) 551
SaqAI TTAA 3 cut(s) 239, 561, 603
SatI GCNGC 1 cut(s) 32
Sau3AI GATC 4 cut(s) 283, 376, 415, 551
Sau96I GGNCC 3 cut(s) 85, 122, 450
SchI GAGTC 1 cut(s) 359
SetI ASST 7 cut(s) 72, 174, 318, 367, 483, 580, 600
SfaNI GCATC 2 cut(s) 253, 265
SfcI CTRYAG 1 cut(s) 192
SinI GGWCC 2 cut(s) 85, 450
SmlI CTYRAG 2 cut(s) 178, 204
SmoI CTYRAG 2 cut(s) 178, 204
Sse9I AATT 5 cut(s) 77, 240, 326, 444, 600
SsiI CCGC 1 cut(s) 88
SspI AATATT 1 cut(s) 372
SspMI CTAG 2 cut(s) 383, 549
TaaI ACNGT 3 cut(s) 39, 53, 617
TaiI ACGT 2 cut(s) 318, 367
TaqI TCGA 1 cut(s) 282
TasI AATT 5 cut(s) 77, 240, 326, 444, 600
TfiI GAWTC 2 cut(s) 245, 309
Tru1I TTAA 3 cut(s) 239, 561, 603
Tru9I TTAA 3 cut(s) 239, 561, 603
TscAI CASTG 3 cut(s) 48, 97, 495
TseI GCWGC 1 cut(s) 31
TspDTI ATGAA 1 cut(s) 603
TspRI CASTG 3 cut(s) 48, 97, 495
VpaK11BI GGWCC 2 cut(s) 85, 450
VspI ATTAAT 1 cut(s) 239
XapI RAATTY 1 cut(s) 326
XcmI CCANNNNNNNNNTGG 1 cut(s) 116
XmiI GTMKAC 1 cut(s) 353
XspI CTAG 2 cut(s) 383, 549
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.