Rmu_ssc0000436.1_g000007

Belongs to the UDP-glycosyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000436.1
OG0001004
Physical Location & Seq
Reverse (-)
25973 .. 26692
720 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000436.1_g000007.1.cds

Sequence Viewer

Length: 720 bp
atggcaagtcaggactggccggttaaaacaataggaccaacaattccatcatcgtttttggacaaacgattgggggatgagaaagattatagtctgagcctgttcaagcctgatcatgtggagacttgcatgaagtggctagactccaaggaaactggctcggtggtttatgtatcgtttggaagcttggcaaacctaacgaaggagcaaatggaagaactagcatggggcttaaacaatagcaactaccacttcttgtgggtaatcaaagagtcagaaaagcaaaagcttccgatcaatttcttcgaggagatatcagagaagggtcttgttgtgagttggtgctcccagcttcgagtcttggcccataaggccgtgggatgctttgttactcattgtggatggaattcaacacttgaggcattgagcttgggagtgccgatggtgacattgccgcaatttgctgatcaaacaacgaatgctaagtttattgcagatgtgtggaaagtaggagtgagagtaaagttgaatgagaaagggtttataacaaaagaggaactagaaatgcgtgttaagcaggttatggacaaggaggtgggggtggagattagaaaggcttcattaatttggaaggagttggctaaggaggccgtggatgaaggaggaagttccgacaggaacattgaggagtttgcggcacaacttcgattattatcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00380 ko00966 ko01110 ko01210 map00380 map00966 map01110 map01210
Pfam Domains
Protein Families
UDPGT

Protein Analysis

239

Amino Acids

27.03

Weight (kDa)

5.54

Isoelectric Point (pI)

32.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 545
Acc36I ACCTGC 1 cut(s) 568
AciI CCGC 2 cut(s) 455, 695
AcoI YGGCCR 1 cut(s) 17
AcsI RAATTY 1 cut(s) 406
AfiI CCNNNNNNNGG 1 cut(s) 202
AgsI TTSAA 3 cut(s) 106, 411, 529
AluBI AGCT 4 cut(s) 186, 289, 352, 429
AluI AGCT 4 cut(s) 186, 289, 352, 429
Alw21I GWGCWC 1 cut(s) 347
Alw26I GTCTC 1 cut(s) 116
AoxI GGCC 4 cut(s) 17, 363, 372, 648
ApoI RAATTY 1 cut(s) 406
AseI ATTAAT 1 cut(s) 623
Asp700I GAANNNNTTC 1 cut(s) 616
AspS9I GGNCC 2 cut(s) 35, 364
AsuHPI GGTGA 1 cut(s) 457
AvaII GGWCC 1 cut(s) 35
Bbv12I GWGCWC 1 cut(s) 347
BccI CCATC 3 cut(s) 55, 396, 436
BceAI ACGGC 2 cut(s) 359, 635
BclI TGATCA 2 cut(s) 112, 466
BcoDI GTCTC 1 cut(s) 116
BfaI CTAG 3 cut(s) 140, 221, 560
BfuAI ACCTGC 1 cut(s) 568
BglI GCCNNNNNGGC 1 cut(s) 371
BisI GCNGC 2 cut(s) 455, 696
BlsI GCNGC 2 cut(s) 456, 697
Bme18I GGWCC 1 cut(s) 35
BmgT120I GGNCC 2 cut(s) 35, 364
BmsI GCATC 1 cut(s) 371
Bpu10I CCTNAGC 1 cut(s) 642
BpuEI CTTGAG 1 cut(s) 437
BsaBI GATNNNNATC 1 cut(s) 712
BsaJI CCNNGG 3 cut(s) 147, 375, 651
BsaXI ACNNNNNCTCC 2 cut(s) 504, 534
Bsc4I CCNNNNNNNGG 1 cut(s) 202
Bse118I RCCGGY 1 cut(s) 19
Bse1I ACTGG 2 cut(s) 20, 160
Bse3DI GCAATG 1 cut(s) 449
Bse8I GATNNNNATC 1 cut(s) 712
BseDI CCNNGG 3 cut(s) 147, 375, 651
BseGI GGATG 4 cut(s) 82, 386, 407, 661
BseJI GATNNNNATC 1 cut(s) 712
BseLI CCNNNNNNNGG 1 cut(s) 202
BseMI GCAATG 1 cut(s) 449
BseMII CTCAG 1 cut(s) 86
BseNI ACTGG 2 cut(s) 20, 160
BseRI GAGGAG 2 cut(s) 323, 701
BseYI CCCAGC 1 cut(s) 348
BshFI GGCC 4 cut(s) 19, 365, 374, 650
BsiHKAI GWGCWC 1 cut(s) 347
BsiSI CCGG 1 cut(s) 20
BslI CCNNNNNNNGG 1 cut(s) 202
BsmAI GTCTC 1 cut(s) 116
BsmI GAATGC 1 cut(s) 484
BsnI GGCC 4 cut(s) 19, 365, 374, 650
Bsp1286I GDGCHC 1 cut(s) 347
Bsp143I GATC 3 cut(s) 112, 294, 466
BspACI CCGC 2 cut(s) 455, 695
BspANI GGCC 4 cut(s) 19, 365, 374, 650
BspCNI CTCAG 1 cut(s) 87
BspMI ACCTGC 1 cut(s) 568
BsrDI GCAATG 1 cut(s) 449
BsrFI RCCGGY 1 cut(s) 19
BsrI ACTGG 2 cut(s) 20, 160
BssAI RCCGGY 1 cut(s) 19
BssECI CCNNGG 3 cut(s) 147, 375, 651
BssMI GATC 3 cut(s) 112, 294, 466
BssT1I CCWWGG 1 cut(s) 147
BstDEI CTNAG 3 cut(s) 95, 483, 642
BstDSI CCRYGG 2 cut(s) 375, 651
BstENI CCTNNNNNAGG 1 cut(s) 200
BstF5I GGATG 4 cut(s) 82, 386, 407, 661
BstKTI GATC 3 cut(s) 115, 297, 469
BstMAI GTCTC 1 cut(s) 116
BstMBI GATC 3 cut(s) 112, 294, 466
BstMWI GCNNNNNNNGC 3 cut(s) 371, 574, 647
BsuRI GGCC 4 cut(s) 19, 365, 374, 650
BtgI CCRYGG 2 cut(s) 375, 651
BtsCI GGATG 4 cut(s) 82, 386, 407, 661
BveI ACCTGC 1 cut(s) 568
Cfr10I RCCGGY 1 cut(s) 19
Cfr13I GGNCC 2 cut(s) 35, 364
CviAII CATG 3 cut(s) 116, 130, 225
DdeI CTNAG 3 cut(s) 95, 483, 642
DpnI GATC 3 cut(s) 114, 296, 468
DpnII GATC 3 cut(s) 112, 294, 466
EaeI YGGCCR 1 cut(s) 17
Eco130I CCWWGG 1 cut(s) 147
Eco32I GATATC 1 cut(s) 315
Eco47I GGWCC 1 cut(s) 35
EcoNI CCTNNNNNAGG 1 cut(s) 200
EcoRI GAATTC 1 cut(s) 406
EcoRV GATATC 1 cut(s) 315
EcoT14I CCWWGG 1 cut(s) 147
ErhI CCWWGG 1 cut(s) 147
FaeI CATG 3 cut(s) 119, 133, 228
FaiI YATR 8 cut(s) 90, 117, 131, 171, 226, 369, 545, 584
FatI CATG 3 cut(s) 115, 129, 224
FbaI TGATCA 2 cut(s) 112, 466
Fnu4HI GCNGC 2 cut(s) 455, 696
FokI GGATG 4 cut(s) 89, 393, 414, 668
Fsp4HI GCNGC 2 cut(s) 455, 696
FspBI CTAG 3 cut(s) 140, 221, 560
GluI GCNGC 2 cut(s) 455, 696
GsaI CCCAGC 1 cut(s) 352
HaeIII GGCC 4 cut(s) 19, 365, 374, 650
HapII CCGG 1 cut(s) 20
Hin1II CATG 3 cut(s) 119, 133, 228
HindIII AAGCTT 2 cut(s) 184, 287
HinfI GANTC 3 cut(s) 143, 272, 357
HpaII CCGG 1 cut(s) 20
HphI GGTGA 1 cut(s) 457
Hpy188I TCNGA 5 cut(s) 96, 277, 294, 319, 673
Hpy188III TCNNGA 2 cut(s) 11, 717
HpyAV CCTTC 4 cut(s) 196, 316, 625, 653
HpyCH4V TGCA 2 cut(s) 129, 494
HpyF10VI GCNNNNNNNGC 3 cut(s) 371, 574, 647
HpyF3I CTNAG 3 cut(s) 95, 483, 642
Hsp92II CATG 3 cut(s) 119, 133, 228
Ksp22I TGATCA 2 cut(s) 112, 466
Kzo9I GATC 3 cut(s) 112, 294, 466
LmnI GCTCC 2 cut(s) 205, 350
LpnPI CCDG 7 cut(s) 33, 113, 123, 141, 362, 563, 661
LweI GCATC 1 cut(s) 371
MaeI CTAG 3 cut(s) 140, 221, 560
MaeIII GTNAC 2 cut(s) 388, 445
MalI GATC 3 cut(s) 114, 296, 468
MboI GATC 3 cut(s) 112, 294, 466
MboII GAAGA 2 cut(s) 227, 295
MhlI GDGCHC 1 cut(s) 347
MluCI AATT 5 cut(s) 42, 298, 406, 458, 624
MlyI GAGTC 3 cut(s) 137, 281, 366
MmeI TCCRAC 1 cut(s) 696
MnlI CCTC 7 cut(s) 301, 412, 547, 586, 640, 656, 679
MroXI GAANNNNTTC 1 cut(s) 616
MseI TTAA 4 cut(s) 24, 233, 573, 623
MspI CCGG 1 cut(s) 20
Mva1269I GAATGC 1 cut(s) 484
MwoI GCNNNNNNNGC 3 cut(s) 371, 574, 647
NdeII GATC 3 cut(s) 112, 294, 466
NlaIII CATG 3 cut(s) 119, 133, 228
NmuCI GTSAC 1 cut(s) 445
PctI GAATGC 1 cut(s) 484
PdmI GAANNNNTTC 1 cut(s) 616
PkrI GCNGC 2 cut(s) 456, 697
PleI GAGTC 3 cut(s) 137, 280, 365
PpsI GAGTC 3 cut(s) 137, 280, 365
PshBI ATTAAT 1 cut(s) 623
PsiI TTATAA 1 cut(s) 545
PspFI CCCAGC 1 cut(s) 348
PspPI GGNCC 2 cut(s) 35, 364
SaqAI TTAA 4 cut(s) 24, 233, 573, 623
SatI GCNGC 2 cut(s) 455, 696
Sau3AI GATC 3 cut(s) 112, 294, 466
Sau96I GGNCC 2 cut(s) 35, 364
SchI GAGTC 3 cut(s) 137, 281, 366
SduI GDGCHC 1 cut(s) 347
SetI ASST 7 cut(s) 188, 198, 291, 354, 431, 582, 597
SfaNI GCATC 1 cut(s) 371
SfiI GGCCNNNNNGGCC 1 cut(s) 371
SinI GGWCC 1 cut(s) 35
SmlI CTYRAG 1 cut(s) 416
SmoI CTYRAG 1 cut(s) 416
Sse9I AATT 5 cut(s) 42, 298, 406, 458, 624
SsiI CCGC 2 cut(s) 455, 695
SspMI CTAG 3 cut(s) 140, 221, 560
StyI CCWWGG 1 cut(s) 147
TaqI TCGA 3 cut(s) 306, 355, 706
TasI AATT 5 cut(s) 42, 298, 406, 458, 624
TauI GCSGC 2 cut(s) 457, 698
Tru1I TTAA 4 cut(s) 24, 233, 573, 623
Tru9I TTAA 4 cut(s) 24, 233, 573, 623
TseFI GTSAC 1 cut(s) 445
Tsp45I GTSAC 1 cut(s) 445
TspDTI ATGAA 3 cut(s) 146, 609, 672
VpaK11BI GGWCC 1 cut(s) 35
VspI ATTAAT 1 cut(s) 623
XagI CCTNNNNNAGG 1 cut(s) 200
XapI RAATTY 1 cut(s) 406
XmnI GAANNNNTTC 1 cut(s) 616
XspI CTAG 3 cut(s) 140, 221, 560
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.