Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0024687.1

Orthogroup ID

OG0001944

Physical Location & Seq

Genomic Coordinates Reverse (-)

3572 .. 4510

Gene Structure 939 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0024687.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 939 bp

atggctcctgactccaacaaagcaaaggactcagcagcttcaatatttaagattcttgacagtaagcctaagatcgactcgagcagcgacgcaggcttaacactaccgagcataagtggaaaaattgatctcgaacatgtcagcttcaaatatcccacaaggccggatgtccagatatttagagacgtttgcttgaatttcccctctggaaaggtaattacaaatcaacactcagtttatgtttgtaaattttattgcttaatgcttagcttaattaatattctatctacacagactgttgctttggttggagagagtggcagtgggaagtcgacagtgattggcctcatagagagattctatgaccccgactcaggtcgtgtactattagatggagtggaaatcaataggttcaagataaactggctgaggcaacaaataggtttggttggtcaagaaccaattctctttaacgcatccattcggaccaatattgcttatggcaagcgaggagatgtaactgaagaacagatcattgcagccacaaaggcatcaaatgctcacaacttcatttcttcattgcctcaaggatatgacacctcagttggggaacgaggcgttcagttatctggagggcagaagcaaagaatagccattgcaagggctattctaaaggacccgaaaattcttttgcttgacgaagctacaagcgcactggatgcagagtcggaacgcatagtacaagatgctttagacagagtgatggtgaatagaacaactgttgtcgttgcgcaccgccttaccacgatcaaaggggcagacataattgctgtggtcaagaacggcgtgattgctgagaagggtagccatgattttctaatgaagatcactgatggtgcttatgcgtctttggtggcacttcattcaagctcaacatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko02010 ko04976 ko05206 ko05226 map02010 map04976 map05206 map05226

Pfam Domains

Protein Families

ABC_membrane ABC_tran

Protein Analysis

312

Amino Acids

33.79

Weight (kDa)

8.32

Isoelectric Point (pI)

31.8

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001944)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G46540
fragaria_vesca	FvH4_3g06540 FvH4_6g19120 FvH4_6g19362 FvH4_7g10050
malus_domestica	MD05G1292400.v1.1 MD10G1268300.v1.1 MD10G1268400.v1.1
prunus_persica	Prupe.4G073000_v2.0.a1
pyrus_communis	pycom05g26870 pycom10g22450 pycom10g22470
rosa_chinensis	RchiOBHm_Chr3g0474221 RchiOBHm_Chr3g0474231 RchiOBHm_Chr3g0479341 RchiOBHm_Chr3g0479351 RchiOBHm_Chr5g0012641
rosa_laevigata	RLG00000023583 RLG00000023903 RLG00000023940 RLG00000031931 RLG00000031945
rosa_multiflora	Rmu_sc0015051.1_g000005 Rmu_sc0024687.1_g000002 Rmu_sc0034046.1_g000001
rosa_roxburghii	Rroxscaffold_1G00063960 Rroxscaffold_6G00402390 Rroxscaffold_6G00407420
rosa_rugosa	Rorug01G0315600 Rorug02G0062500 Rorug03G0139600 Rorug05G0003300 Rorug05G0003400 Rorug05G0313000
rosa_samantha	Rh3AG190100 Rh3AG225500 Rh3AG225700 Rh3BG219300 Rh4DG026100 Rh5AG097000 Rh5BG093600 Rh5CG106000 Rh5DG092700
rosa_wichuraiana	Rw3G017340 Rw5G008520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	792
AccI	GTMKAC	1 cut(s)	332
AciI	CCGC	1 cut(s)	796
AcsI	RAATTY	3 cut(s)	196, 248, 684
AcuI	CTGAAG	1 cut(s)	543
AfaI	GTAC	2 cut(s)	384, 741
AfiI	CCNNNNNNNGG	3 cut(s)	374, 606, 660
AflIII	ACRYGT	1 cut(s)	136
AgsI	TTSAA	5 cut(s)	42, 148, 196, 415, 927
AluBI	AGCT	5 cut(s)	38, 144, 270, 704, 930
AluI	AGCT	5 cut(s)	38, 144, 270, 704, 930
Alw26I	GTCTC	1 cut(s)	177
Ama87I	CYCGRG	1 cut(s)	79
AoxI	GGCC	2 cut(s)	161, 343
ApeKI	GCWGC	3 cut(s)	35, 84, 539
ApoI	RAATTY	3 cut(s)	196, 248, 684
ArsI	GACNNNNNNTTYG	2 cut(s)	286, 318
AseI	ATTAAT	1 cut(s)	276
Asp700I	GAANNNNTTC	1 cut(s)	462
AspLEI	GCGC	2 cut(s)	713, 793
AspS9I	GGNCC	2 cut(s)	486, 676
AsuHPI	GGTGA	1 cut(s)	778
AvaI	CYCGRG	1 cut(s)	79
AvaII	GGWCC	2 cut(s)	486, 676
BbvCI	CCTCAGC	1 cut(s)	428
BbvI	GCAGC	3 cut(s)	47, 96, 551
BccI	CCATC	3 cut(s)	386, 757, 887
BceAI	ACGGC	1 cut(s)	859
BcoDI	GTCTC	1 cut(s)	177
BglI	GCCNNNNNGGC	1 cut(s)	548
BisI	GCNGC	3 cut(s)	36, 85, 540
BlpI	GCTNAGC	1 cut(s)	266
BlsI	GCNGC	3 cut(s)	37, 86, 541
Bme18I	GGWCC	2 cut(s)	486, 676
BmeT110I	CYCGRG	1 cut(s)	79
BmgT120I	GGNCC	2 cut(s)	486, 676
BmiI	GGNNCC	2 cut(s)	6, 678
BmsI	GCATC	4 cut(s)	485, 560, 709, 736
BoxI	GACNNNNGTC	1 cut(s)	375
BpmI	CTGGAG	1 cut(s)	651
Bpu10I	CCTNAGC	1 cut(s)	428
Bpu1102I	GCTNAGC	1 cut(s)	266
BpuEI	CTTGAG	1 cut(s)	570
Bsc4I	CCNNNNNNNGG	3 cut(s)	374, 606, 660
Bse1I	ACTGG	2 cut(s)	428, 720
Bse3DI	GCAATG	3 cut(s)	534, 578, 654
BseGI	GGATG	3 cut(s)	172, 476, 724
BseLI	CCNNNNNNNGG	3 cut(s)	374, 606, 660
BseMI	GCAATG	3 cut(s)	534, 578, 654
BseMII	CTCAG	6 cut(s)	45, 246, 387, 419, 615, 846
BseNI	ACTGG	2 cut(s)	428, 720
BseRI	GAGGAG	1 cut(s)	525
BseXI	GCAGC	3 cut(s)	47, 96, 551
BshFI	GGCC	2 cut(s)	163, 345
BsiHKCI	CYCGRG	1 cut(s)	79
BsiSI	CCGG	1 cut(s)	164
BslI	CCNNNNNNNGG	3 cut(s)	374, 606, 660
BsmAI	GTCTC	1 cut(s)	177
BsmBI	CGTCTC	1 cut(s)	177
BsnI	GGCC	2 cut(s)	163, 345
BsoBI	CYCGRG	1 cut(s)	79
Bsp143I	GATC	5 cut(s)	72, 127, 531, 807, 885
Bsp1720I	GCTNAGC	1 cut(s)	266
BspACI	CCGC	1 cut(s)	796
BspANI	GGCC	2 cut(s)	163, 345
BspCNI	CTCAG	6 cut(s)	44, 245, 386, 420, 614, 847
BspLI	GGNNCC	2 cut(s)	6, 678
BsrDI	GCAATG	3 cut(s)	534, 578, 654
BsrI	ACTGG	2 cut(s)	428, 720
BssMI	GATC	5 cut(s)	72, 127, 531, 807, 885
Bst4CI	ACNGT	4 cut(s)	62, 298, 337, 781
BstAPI	GCANNNNNTGC	2 cut(s)	557, 719
BstC8I	GCNNGC	2 cut(s)	94, 506
BstDEI	CTNAG	8 cut(s)	31, 69, 232, 266, 373, 428, 601, 855
BstF5I	GGATG	3 cut(s)	172, 476, 724
BstHHI	GCGC	2 cut(s)	713, 793
BstKTI	GATC	5 cut(s)	75, 130, 534, 810, 888
BstMAI	GTCTC	1 cut(s)	177
BstMBI	GATC	5 cut(s)	72, 127, 531, 807, 885
BstMWI	GCNNNNNNNGC	5 cut(s)	93, 548, 557, 710, 719
BstNSI	RCATGY	1 cut(s)	140
BstPAI	GACNNNNGTC	1 cut(s)	375
BstV1I	GCAGC	3 cut(s)	47, 96, 551
BsuRI	GGCC	2 cut(s)	163, 345
BtsCI	GGATG	3 cut(s)	172, 476, 724
BtsI	GCAGTG	1 cut(s)	328
BtsIMutI	CAGTG	4 cut(s)	328, 342, 713, 888
Cac8I	GCNNGC	2 cut(s)	94, 506
CfoI	GCGC	2 cut(s)	713, 793
Cfr13I	GGNCC	2 cut(s)	486, 676
CseI	GACGC	2 cut(s)	98, 894
Csp6I	GTAC	2 cut(s)	383, 740
CviAII	CATG	3 cut(s)	137, 869, 936
CviQI	GTAC	2 cut(s)	383, 740
DdeI	CTNAG	8 cut(s)	31, 69, 232, 266, 373, 428, 601, 855
DpnI	GATC	5 cut(s)	74, 129, 533, 809, 887
DpnII	GATC	5 cut(s)	72, 127, 531, 807, 885
Eco47I	GGWCC	2 cut(s)	486, 676
Eco57I	CTGAAG	1 cut(s)	543
Eco88I	CYCGRG	1 cut(s)	79
EcoO109I	RGGNCCY	1 cut(s)	676
Esp3I	CGTCTC	1 cut(s)	177
FaeI	CATG	3 cut(s)	140, 872, 939
FatI	CATG	3 cut(s)	136, 868, 935
FblI	GTMKAC	1 cut(s)	332
Fnu4HI	GCNGC	3 cut(s)	36, 85, 540
FokI	GGATG	3 cut(s)	179, 463, 731
Fsp4HI	GCNGC	3 cut(s)	36, 85, 540
FspI	TGCGCA	1 cut(s)	792
GlaI	GCGC	2 cut(s)	712, 792
GluI	GCNGC	3 cut(s)	36, 85, 540
GsuI	CTGGAG	1 cut(s)	651
HaeIII	GGCC	2 cut(s)	163, 345
HapII	CCGG	1 cut(s)	164
HgaI	GACGC	2 cut(s)	98, 894
HhaI	GCGC	2 cut(s)	713, 793
Hin1II	CATG	3 cut(s)	140, 872, 939
Hin6I	GCGC	2 cut(s)	711, 791
HinP1I	GCGC	2 cut(s)	711, 791
HincII	GTYRAC	1 cut(s)	333
HindII	GTYRAC	1 cut(s)	333
HinfI	GANTC	7 cut(s)	11, 29, 52, 77, 357, 371, 725
HpaII	CCGG	1 cut(s)	164
HphI	GGTGA	1 cut(s)	778
Hpy166II	GTNNAC	2 cut(s)	333, 383
Hpy188I	TCNGA	2 cut(s)	486, 730
Hpy188III	TCNNGA	9 cut(s)	8, 56, 131, 172, 207, 415, 455, 630, 838
Hpy8I	GTNNAC	2 cut(s)	333, 383
Hpy99I	CGWCG	1 cut(s)	92
HpyAV	CCTTC	1 cut(s)	853
HpyCH4III	ACNGT	4 cut(s)	62, 298, 337, 781
HpyCH4IV	ACGT	1 cut(s)	186
HpyCH4V	TGCA	3 cut(s)	539, 659, 722
HpyF10VI	GCNNNNNNNGC	5 cut(s)	93, 548, 557, 710, 719
HpyF3I	CTNAG	8 cut(s)	31, 69, 232, 266, 373, 428, 601, 855
HpySE526I	ACGT	1 cut(s)	186
Hsp92II	CATG	3 cut(s)	140, 872, 939
HspAI	GCGC	2 cut(s)	711, 791
Kzo9I	GATC	5 cut(s)	72, 127, 531, 807, 885
LmnI	GCTCC	1 cut(s)	10
LpnPI	CCDG	9 cut(s)	21, 78, 177, 185, 192, 360, 409, 615, 701
Lsp1109I	GCAGC	3 cut(s)	47, 96, 551
LweI	GCATC	4 cut(s)	485, 560, 709, 736
MaeII	ACGT	1 cut(s)	186
MaeIII	GTNAC	1 cut(s)	517
MalI	GATC	5 cut(s)	74, 129, 533, 809, 887
MboI	GATC	5 cut(s)	72, 127, 531, 807, 885
MboII	GAAGA	3 cut(s)	536, 567, 895
MluCI	AATT	8 cut(s)	123, 196, 216, 248, 273, 462, 684, 825
MlyI	GAGTC	5 cut(s)	5, 23, 71, 365, 734
MmeI	TCCRAC	3 cut(s)	39, 289, 708
MnlI	CCTC	8 cut(s)	214, 356, 423, 503, 594, 608, 610, 626
MroXI	GAANNNNTTC	1 cut(s)	462
MseI	TTAA	6 cut(s)	48, 98, 260, 272, 276, 471
MspI	CCGG	1 cut(s)	164
MwoI	GCNNNNNNNGC	5 cut(s)	93, 548, 557, 710, 719
NdeII	GATC	5 cut(s)	72, 127, 531, 807, 885
NlaIII	CATG	3 cut(s)	140, 872, 939
NlaIV	GGNNCC	2 cut(s)	6, 678
NsbI	TGCGCA	1 cut(s)	792
NspI	RCATGY	1 cut(s)	140
PacI	TTAATTAA	1 cut(s)	276
PaeR7I	CTCGAG	1 cut(s)	79
PciI	ACATGT	1 cut(s)	136
PdmI	GAANNNNTTC	1 cut(s)	462
PfeI	GAWTC	2 cut(s)	52, 357
PkrI	GCNGC	3 cut(s)	37, 86, 541
PleI	GAGTC	5 cut(s)	5, 23, 71, 365, 733
PpsI	GAGTC	5 cut(s)	5, 23, 71, 365, 733
PpuMI	RGGWCCY	1 cut(s)	676
PscI	ACATGT	1 cut(s)	136
PshAI	GACNNNNGTC	1 cut(s)	375
PshBI	ATTAAT	1 cut(s)	276
Psp5II	RGGWCCY	1 cut(s)	676
PspN4I	GGNNCC	2 cut(s)	6, 678
PspPI	GGNCC	2 cut(s)	486, 676
PspPPI	RGGWCCY	1 cut(s)	676
PspXI	VCTCGAGB	1 cut(s)	79
PsrI	GAACNNNNNNTAC	2 cut(s)	723, 755
RsaI	GTAC	2 cut(s)	384, 741
RsaNI	GTAC	2 cut(s)	383, 740
SalI	GTCGAC	1 cut(s)	331
SaqAI	TTAA	6 cut(s)	48, 98, 260, 272, 276, 471
SatI	GCNGC	3 cut(s)	36, 85, 540
Sau3AI	GATC	5 cut(s)	72, 127, 531, 807, 885
Sau96I	GGNCC	2 cut(s)	486, 676
SchI	GAGTC	5 cut(s)	5, 23, 71, 365, 734
SfaNI	GCATC	4 cut(s)	485, 560, 709, 736
Sfr274I	CTCGAG	1 cut(s)	79
SinI	GGWCC	2 cut(s)	486, 676
SlaI	CTCGAG	1 cut(s)	79
SmlI	CTYRAG	2 cut(s)	79, 585
SmoI	CTYRAG	2 cut(s)	79, 585
Sse9I	AATT	8 cut(s)	123, 196, 216, 248, 273, 462, 684, 825
SsiI	CCGC	1 cut(s)	796
SspI	AATATT	3 cut(s)	45, 280, 493
TaaI	ACNGT	4 cut(s)	62, 298, 337, 781
TaiI	ACGT	1 cut(s)	189
TaqI	TCGA	4 cut(s)	75, 80, 132, 332
TasI	AATT	8 cut(s)	123, 196, 216, 248, 273, 462, 684, 825
TatI	WGTACW	2 cut(s)	382, 739
TfiI	GAWTC	2 cut(s)	52, 357
Tru1I	TTAA	6 cut(s)	48, 98, 260, 272, 276, 471
Tru9I	TTAA	6 cut(s)	48, 98, 260, 272, 276, 471
TscAI	CASTG	4 cut(s)	328, 342, 720, 895
TseI	GCWGC	3 cut(s)	35, 84, 539
TspDTI	ATGAA	4 cut(s)	559, 567, 896, 911
TspRI	CASTG	4 cut(s)	328, 342, 720, 895
VpaK11BI	GGWCC	2 cut(s)	486, 676
VspI	ATTAAT	1 cut(s)	276
XapI	RAATTY	3 cut(s)	196, 248, 684
XceI	RCATGY	1 cut(s)	140
XhoI	CTCGAG	1 cut(s)	79
XmiI	GTMKAC	1 cut(s)	332
XmnI	GAANNNNTTC	1 cut(s)	462

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.