Rroxscaffold_1G00046880

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0000715
Physical Location & Seq
Forward (+)
66345371 .. 66347168
1798 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00046880.1

Sequence Viewer

Length: 195 bp
ATGGGAAGGATTTTCATTAGAACCATTCCAATATATCATGACTGGTTTGAAACTTGCCCTTCCCTCTGCAACAATGGAATGTTTGGAGGAGTGGGCTTTCGAGATTCTTGTGTTTATGGGAGGATTGATGCCAAACTCGACGAGAACAACTTCACTACTTGCAATGTGGTCAGCTTCAATAACATTTTTCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.33

Weight (kDa)

5.53

Isoelectric Point (pI)

23.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000715)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G23550 AT3G23560 AT3G23560
fragaria_vesca FvH4_1g15630 FvH4_1g15630 FvH4_3g19700 FvH4_3g19700 FvH4_3g19700 FvH4_3g19700 FvH4_3g19700 FvH4_3g19720 FvH4_3g20060 FvH4_3g20060 FvH4_3g20060 FvH4_3g20060 FvH4_5g31740 FvH4_7g19991
malus_domestica MD03G1230300.v1.1 MD11G1250700.v1.1 MD11G1251300.v1.1 MD11G1251400.v1.1 MD11G1251500.v1.1 MD12G1088700.v1.1
prunus_persica Prupe.4G177700_v2.0.a1 Prupe.4G177700_v2.0.a1 Prupe.4G177900_v2.0.a1 Prupe.4G178700_v2.0.a1 Prupe.4G178700_v2.0.a1 Prupe.4G178700_v2.0.a1 Prupe.4G178700_v2.0.a1 Prupe.4G178700_v2.0.a1 Prupe.4G178700_v2.0.a1 Prupe.4G178700_v2.0.a1 Prupe.4G178700_v2.0.a1 Prupe.4G178700_v2.0.a1 Prupe.4G178700_v2.0.a1 Prupe.4G178700_v2.0.a1 Prupe.4G178700_v2.0.a1 Prupe.4G178900_v2.0.a1 Prupe.4G178900_v2.0.a1 Prupe.4G178900_v2.0.a1 Prupe.4G206700_v2.0.a1
pyrus_communis pycom03g17780 pycom10g06980 pycom11g22170 pycom11g22270
rosa_chinensis RchiOBHm_Chr5g0033011 RchiOBHm_Chr5g0033061
rosa_laevigata RLG00000033443 RLG00000033445
rosa_multiflora Rmu_sc0000986.1_g000015
rosa_roxburghii Rroxscaffold_1G00046880 Rroxscaffold_1G00046890 Rroxscaffold_1G00046990 Rroxscaffold_1G00047000 Rroxscaffold_1G00047040
rosa_rugosa Rorug05G0135000 Rorug05G0135100 Rorug05G0135200 Rorug05G0135500 Rorug05G0135600 Rorug05G0135700 Rorug05G0135800
rosa_samantha Rh5AG227700 Rh5AG228200 Rh5BG229300 Rh5BG229400 Rh5CG256700 Rh5CG257200 Rh5DG233900 Rh5DG234100
rosa_wichuraiana Rw5G020860 Rw5G020880

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 50, 178
AluBI AGCT 1 cut(s) 174
AluI AGCT 1 cut(s) 174
Asp700I GAANNNNTTC 1 cut(s) 149
BfmI CTRYAG 1 cut(s) 191
BmsI GCATC 1 cut(s) 118
Bse1I ACTGG 1 cut(s) 47
Bse3DI GCAATG 1 cut(s) 169
BseMI GCAATG 1 cut(s) 169
BseNI ACTGG 1 cut(s) 47
BseRI GAGGAG 1 cut(s) 102
BspHI TCATGA 1 cut(s) 37
BsrDI GCAATG 1 cut(s) 169
BsrI ACTGG 1 cut(s) 47
BstSFI CTRYAG 1 cut(s) 191
CciI TCATGA 1 cut(s) 37
CviAII CATG 1 cut(s) 38
CviJI RGCY 2 cut(s) 96, 174
CviKI_1 RGCY 2 cut(s) 96, 174
FaeI CATG 1 cut(s) 41
FaiI YATR 3 cut(s) 34, 39, 117
FatI CATG 1 cut(s) 37
Hin1II CATG 1 cut(s) 41
HinfI GANTC 1 cut(s) 104
Hpy188III TCNNGA 2 cut(s) 38, 101
Hpy99I CGWCG 1 cut(s) 143
HpyAV CCTTC 1 cut(s) 69
HpyCH4V TGCA 2 cut(s) 69, 162
Hsp92II CATG 1 cut(s) 41
LpnPI CCDG 1 cut(s) 28
LweI GCATC 1 cut(s) 118
MnlI CCTC 3 cut(s) 74, 80, 114
MroXI GAANNNNTTC 1 cut(s) 149
NlaIII CATG 1 cut(s) 41
PagI TCATGA 1 cut(s) 37
PdmI GAANNNNTTC 1 cut(s) 149
PfeI GAWTC 1 cut(s) 104
SetI ASST 1 cut(s) 176
SfaNI GCATC 1 cut(s) 118
SfcI CTRYAG 1 cut(s) 191
SgeI CNNG 8 cut(s) 50, 55, 66, 113, 120, 149, 154, 171
TaqI TCGA 2 cut(s) 100, 138
TfiI GAWTC 1 cut(s) 104
TspDTI ATGAA 1 cut(s) 4
XmnI GAANNNNTTC 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.