Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000002

Orthogroup ID

OG0001756

Physical Location & Seq

Genomic Coordinates Reverse (-)

63907539 .. 63907920

Gene Structure 382 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_2G00128240.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 153 bp

ATGCTCCTTGAATCCTCCTTGATGGTGGAATGGATGGATAATGAACTTCTTGATGGTGATGATGAATGGAATGGTGATGAAGATATGATGCTCATTTGGCTAACTTTGAGTGGTAGTGGTGGTGATGAAGTTTATGGTGGTGGAAGATGGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

50

Amino Acids

5.67

Weight (kDa)

4.05

Isoelectric Point (pI)

37.09

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001756)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g22375
rosa_chinensis	RchiOBHm_Chr3g0482361 RchiOBHm_Chr4g0398941 RchiOBHm_Chr4g0410131 RchiOBHm_Chr4g0414411 RchiOBHm_Chr4g0439801 RchiOBHm_Chr5g0001911 RchiOBHm_Chr5g0007811 RchiOBHm_Chr5g0014191 RchiOBHm_Chr5g0040521 RchiOBHm_Chr5g0060701 RchiOBHm_Chr6g0270991 RchiOBHm_Chr6g0312491 RchiOBHm_Chr7g0226901
rosa_multiflora	Rmu_co8433019.1_g000001 Rmu_sc0001578.1_g000013 Rmu_sc0003226.1_g000060 Rmu_sc0009149.1_g000012 Rmu_sc0025211.1_g000004 Rmu_sc0041581.1_g000003
rosa_roxburghii	Rroxscaffold_1G00010170 Rroxscaffold_1G00014620 Rroxscaffold_1G00020060 Rroxscaffold_1G00023340 Rroxscaffold_2G00077810 Rroxscaffold_2G00077820 Rroxscaffold_2G00103990 Rroxscaffold_2G00113000 Rroxscaffold_2G00115650 Rroxscaffold_2G00128240 Rroxscaffold_2G00155150 Rroxscaffold_3G00257980 Rroxscaffold_3G00259740 Rroxscaffold_4G00292940 Rroxscaffold_4G00299500 Rroxscaffold_4G00306180 Rroxscaffold_4G00318610 Rroxscaffold_4G00321500 Rroxscaffold_4G00324360 Rroxscaffold_5G00354950 Rroxscaffold_5G00362380 Rroxscaffold_7G00162030 Rroxscaffold_7G00183190
rosa_rugosa	Rorug05G0251500
rosa_samantha	Rh4DG198500 Rh5AG328100 Rh5AG420900
rosa_wichuraiana	Rw2G021730

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	11
AsuHPI	GGTGA	3 cut(s)	68, 86, 134
BccI	CCATC	4 cut(s)	16, 28, 47, 141
BmsI	GCATC	1 cut(s)	78
BseGI	GGATG	1 cut(s)	39
BstF5I	GGATG	1 cut(s)	39
BstMWI	GCNNNNNNNGC	1 cut(s)	97
BtsCI	GGATG	1 cut(s)	39
CviJI	RGCY	1 cut(s)	100
CviKI_1	RGCY	1 cut(s)	100
FaiI	YATR	2 cut(s)	86, 135
FokI	GGATG	1 cut(s)	46
HinfI	GANTC	1 cut(s)	11
HphI	GGTGA	3 cut(s)	68, 86, 134
Hpy188III	TCNNGA	1 cut(s)	50
HpyF10VI	GCNNNNNNNGC	1 cut(s)	97
LmnI	GCTCC	1 cut(s)	9
LweI	GCATC	1 cut(s)	78
MboII	GAAGA	1 cut(s)	92
MnlI	CCTC	1 cut(s)	25
MwoI	GCNNNNNNNGC	1 cut(s)	97
PfeI	GAWTC	1 cut(s)	11
SfaNI	GCATC	1 cut(s)	78
SgeI	CNNG	3 cut(s)	20, 31, 62
TfiI	GAWTC	1 cut(s)	11
TspDTI	ATGAA	4 cut(s)	57, 78, 93, 141

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.