Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000003

Orthogroup ID

OG0001756

Physical Location & Seq

Genomic Coordinates Forward (+)

52325991 .. 52326742

Gene Structure 752 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_3G00257980.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 300 bp

ATGCATAAAGATTTGAGTTTAGATAATCAAGCAAGCAAACCAATCCTAGATCTAGGTGATTTTAACTCACTCATAGAGGATGCTATCATGCTATTAATGTTCAAGTTTATGGTGGTGGAAGATGGTAGTTGTGGTGGTGATGATGGAGTAGATTGGGTATTGTGGGTTTGGATTTTGGGAGGTGGAGATGGAGGTTTTGTGAAGGAGATGAAGAGAGAAATCAGATGTAATGGGATGAAGGAATTCGTCATTGAGAGTGAGAGGAGAATGTGTTTAAATATGGAAGAAAAAGAAGAGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

99

Amino Acids

11.29

Weight (kDa)

4.45

Isoelectric Point (pI)

60.01

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001756)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g22375
rosa_chinensis	RchiOBHm_Chr3g0482361 RchiOBHm_Chr4g0398941 RchiOBHm_Chr4g0410131 RchiOBHm_Chr4g0414411 RchiOBHm_Chr4g0439801 RchiOBHm_Chr5g0001911 RchiOBHm_Chr5g0007811 RchiOBHm_Chr5g0014191 RchiOBHm_Chr5g0040521 RchiOBHm_Chr5g0060701 RchiOBHm_Chr6g0270991 RchiOBHm_Chr6g0312491 RchiOBHm_Chr7g0226901
rosa_multiflora	Rmu_co8433019.1_g000001 Rmu_sc0001578.1_g000013 Rmu_sc0003226.1_g000060 Rmu_sc0009149.1_g000012 Rmu_sc0025211.1_g000004 Rmu_sc0041581.1_g000003
rosa_roxburghii	Rroxscaffold_1G00010170 Rroxscaffold_1G00014620 Rroxscaffold_1G00020060 Rroxscaffold_1G00023340 Rroxscaffold_2G00077810 Rroxscaffold_2G00077820 Rroxscaffold_2G00103990 Rroxscaffold_2G00113000 Rroxscaffold_2G00115650 Rroxscaffold_2G00128240 Rroxscaffold_2G00155150 Rroxscaffold_3G00257980 Rroxscaffold_3G00259740 Rroxscaffold_4G00292940 Rroxscaffold_4G00299500 Rroxscaffold_4G00306180 Rroxscaffold_4G00318610 Rroxscaffold_4G00321500 Rroxscaffold_4G00324360 Rroxscaffold_5G00354950 Rroxscaffold_5G00362380 Rroxscaffold_7G00162030 Rroxscaffold_7G00183190
rosa_rugosa	Rorug05G0251500
rosa_samantha	Rh4DG198500 Rh5AG328100 Rh5AG420900
rosa_wichuraiana	Rw2G021730

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	242
AgsI	TTSAA	1 cut(s)	103
ApoI	RAATTY	1 cut(s)	242
AseI	ATTAAT	1 cut(s)	95
Asp700I	GAANNNNTTC	1 cut(s)	242
AsuHPI	GGTGA	2 cut(s)	68, 149
BccI	CCATC	3 cut(s)	116, 137, 182
BfaI	CTAG	2 cut(s)	47, 53
BglII	AGATCT	1 cut(s)	49
BmsI	GCATC	1 cut(s)	70
BsaXI	ACNNNNNCTCC	4 cut(s)	183, 213, 256, 286
BseGI	GGATG	2 cut(s)	85, 240
BseRI	GAGGAG	1 cut(s)	277
Bsp143I	GATC	1 cut(s)	49
BssMI	GATC	1 cut(s)	49
Bst6I	CTCTTC	2 cut(s)	206, 288
BstC8I	GCNNGC	1 cut(s)	34
BstF5I	GGATG	2 cut(s)	85, 240
BstKTI	GATC	1 cut(s)	52
BstMBI	GATC	1 cut(s)	49
BstX2I	RGATCY	1 cut(s)	49
BstYI	RGATCY	1 cut(s)	49
BtsCI	GGATG	2 cut(s)	85, 240
Cac8I	GCNNGC	1 cut(s)	34
CviAII	CATG	1 cut(s)	88
DpnI	GATC	1 cut(s)	51
DpnII	GATC	1 cut(s)	49
DraI	TTTAAA	1 cut(s)	276
Eam1104I	CTCTTC	2 cut(s)	206, 288
EarI	CTCTTC	2 cut(s)	206, 288
EcoRI	GAATTC	1 cut(s)	242
EcoT22I	ATGCAT	1 cut(s)	6
FaeI	CATG	1 cut(s)	91
FaiI	YATR	5 cut(s)	6, 74, 89, 110, 281
FatI	CATG	1 cut(s)	87
FokI	GGATG	2 cut(s)	92, 247
FspBI	CTAG	2 cut(s)	47, 53
Hin1II	CATG	1 cut(s)	91
HphI	GGTGA	2 cut(s)	68, 149
Hpy188I	TCNGA	1 cut(s)	224
HpyAV	CCTTC	2 cut(s)	196, 232
HpyCH4V	TGCA	1 cut(s)	4
Hsp92II	CATG	1 cut(s)	91
Kzo9I	GATC	1 cut(s)	49
LweI	GCATC	1 cut(s)	70
MaeI	CTAG	2 cut(s)	47, 53
MalI	GATC	1 cut(s)	51
MboI	GATC	1 cut(s)	49
MboII	GAAGA	3 cut(s)	131, 223, 296
MflI	RGATCY	1 cut(s)	49
MluCI	AATT	1 cut(s)	242
MnlI	CCTC	4 cut(s)	70, 173, 185, 255
Mph1103I	ATGCAT	1 cut(s)	6
MroXI	GAANNNNTTC	1 cut(s)	242
MseI	TTAA	3 cut(s)	63, 95, 275
NdeII	GATC	1 cut(s)	49
NlaIII	CATG	1 cut(s)	91
NsiI	ATGCAT	1 cut(s)	6
PdmI	GAANNNNTTC	1 cut(s)	242
PshBI	ATTAAT	1 cut(s)	95
PsuI	RGATCY	1 cut(s)	49
SaqAI	TTAA	3 cut(s)	63, 95, 275
Sau3AI	GATC	1 cut(s)	49
SetI	ASST	3 cut(s)	58, 184, 196
SfaNI	GCATC	1 cut(s)	70
SgeI	CNNG	6 cut(s)	41, 45, 59, 65, 100, 115
Sse9I	AATT	1 cut(s)	242
SspMI	CTAG	2 cut(s)	47, 53
TasI	AATT	1 cut(s)	242
Tru1I	TTAA	3 cut(s)	63, 95, 275
Tru9I	TTAA	3 cut(s)	63, 95, 275
TspDTI	ATGAA	2 cut(s)	224, 251
VspI	ATTAAT	1 cut(s)	95
XapI	RAATTY	1 cut(s)	242
XmnI	GAANNNNTTC	1 cut(s)	242
XspI	CTAG	2 cut(s)	47, 53
Zsp2I	ATGCAT	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.