Rroxscaffold_4G00298950

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
18875112 .. 18881830
6719 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00298950.1

Sequence Viewer

Length: 258 bp
ATGGCTAATTATTGGCGCTATTTCAGGTGGATGGTGAGCCACGCATATACGGAGGAGGAGGATGGAGCAAGGGATATACTCGTGAAATTGTTAAGGGACACTTCCTATAAACCACAAGGTTCCTCCAATCCTGTATTCTCGGGGAGGAGATTCAAGTCACCAGCAAGAAGGATCAAACCAGGAAAGAAGCCTGCAGAAGGTTCTACTTCTACCACAAACTCTAGGACTGATTCAAGAAAGCCCTCATGGAAGTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.92

Weight (kDa)

10.32

Isoelectric Point (pI)

60.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 179
AfiI CCNNNNNNNGG 1 cut(s) 197
AgsI TTSAA 2 cut(s) 154, 234
AjnI CCWGG 1 cut(s) 178
AjuI GAANNNNNNNTTGG 2 cut(s) 119, 151
AlwI GGATC 1 cut(s) 179
Ama87I CYCGRG 1 cut(s) 139
AspLEI GCGC 1 cut(s) 18
AsuHPI GGTGA 2 cut(s) 46, 150
AvaI CYCGRG 1 cut(s) 139
BauI CACGAG 1 cut(s) 80
BccI CCATC 2 cut(s) 25, 56
BciT130I CCWGG 1 cut(s) 180
BfaI CTAG 1 cut(s) 222
BfmI CTRYAG 1 cut(s) 192
BfoI RGCGCY 1 cut(s) 19
Bme1390I CCNGG 1 cut(s) 180
BmeT110I CYCGRG 1 cut(s) 139
BmiI GGNNCC 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 180
Bsc4I CCNNNNNNNGG 1 cut(s) 197
BseBI CCWGG 1 cut(s) 180
BseGI GGATG 2 cut(s) 36, 67
BseLI CCNNNNNNNGG 1 cut(s) 197
BseRI GAGGAG 3 cut(s) 68, 71, 160
BsiHKCI CYCGRG 1 cut(s) 139
BslFI GGGAC 1 cut(s) 110
BslI CCNNNNNNNGG 1 cut(s) 197
BsmFI GGGAC 1 cut(s) 110
BsoBI CYCGRG 1 cut(s) 139
Bsp143I GATC 1 cut(s) 171
BspLI GGNNCC 1 cut(s) 121
BspMAI CTGCAG 1 cut(s) 196
BspPI GGATC 1 cut(s) 179
BssMI GATC 1 cut(s) 171
BssSI CACGAG 1 cut(s) 80
Bst2BI CACGAG 1 cut(s) 80
Bst2UI CCWGG 1 cut(s) 180
BstC8I GCNNGC 1 cut(s) 192
BstENI CCTNNNNNAGG 1 cut(s) 195
BstF5I GGATG 2 cut(s) 36, 67
BstH2I RGCGCY 1 cut(s) 19
BstHHI GCGC 1 cut(s) 18
BstKTI GATC 1 cut(s) 174
BstMBI GATC 1 cut(s) 171
BstNI CCWGG 1 cut(s) 180
BstSCI CCNGG 1 cut(s) 178
BstSFI CTRYAG 1 cut(s) 192
BtsCI GGATG 2 cut(s) 36, 67
Cac8I GCNNGC 1 cut(s) 192
CfoI GCGC 1 cut(s) 18
CviAII CATG 1 cut(s) 246
CviJI RGCY 4 cut(s) 5, 39, 190, 241
CviKI_1 RGCY 4 cut(s) 5, 39, 190, 241
DpnI GATC 1 cut(s) 173
DpnII GATC 1 cut(s) 171
Eco88I CYCGRG 1 cut(s) 139
EcoNI CCTNNNNNAGG 1 cut(s) 195
EcoRII CCWGG 1 cut(s) 178
FaeI CATG 1 cut(s) 249
FaiI YATR 5 cut(s) 46, 48, 77, 108, 247
FalI AAGNNNNNCTT 2 cut(s) 85, 117
FaqI GGGAC 1 cut(s) 110
FatI CATG 1 cut(s) 245
FokI GGATG 2 cut(s) 43, 74
FspBI CTAG 1 cut(s) 222
GlaI GCGC 1 cut(s) 17
HaeII RGCGCY 1 cut(s) 19
HhaI GCGC 1 cut(s) 18
Hin1II CATG 1 cut(s) 249
Hin6I GCGC 1 cut(s) 16
HinP1I GCGC 1 cut(s) 16
HinfI GANTC 2 cut(s) 150, 230
HphI GGTGA 2 cut(s) 46, 150
Hpy188III TCNNGA 2 cut(s) 82, 234
HpyAV CCTTC 2 cut(s) 162, 191
HpyCH4V TGCA 1 cut(s) 194
Hsp92II CATG 1 cut(s) 249
HspAI GCGC 1 cut(s) 16
Kzo9I GATC 1 cut(s) 171
LmnI GCTCC 1 cut(s) 65
LpnPI CCDG 6 cut(s) 10, 144, 165, 174, 192, 204
MaeI CTAG 1 cut(s) 222
MaeIII GTNAC 1 cut(s) 156
MalI GATC 1 cut(s) 173
MboI GATC 1 cut(s) 171
MluCI AATT 2 cut(s) 7, 86
MnlI CCTC 6 cut(s) 46, 49, 52, 133, 138, 253
MseI TTAA 1 cut(s) 92
MspR9I CCNGG 1 cut(s) 180
MvaI CCWGG 1 cut(s) 180
NdeII GATC 1 cut(s) 171
NlaIII CATG 1 cut(s) 249
NlaIV GGNNCC 1 cut(s) 121
NmuCI GTSAC 1 cut(s) 156
PfeI GAWTC 2 cut(s) 150, 230
Psp6I CCWGG 1 cut(s) 178
PspGI CCWGG 1 cut(s) 178
PspN4I GGNNCC 1 cut(s) 121
PstI CTGCAG 1 cut(s) 196
SaqAI TTAA 1 cut(s) 92
Sau3AI GATC 1 cut(s) 171
ScrFI CCNGG 1 cut(s) 180
SetI ASST 3 cut(s) 29, 121, 202
SfcI CTRYAG 1 cut(s) 192
Sse9I AATT 2 cut(s) 7, 86
SspMI CTAG 1 cut(s) 222
StyD4I CCNGG 1 cut(s) 178
TasI AATT 2 cut(s) 7, 86
TfiI GAWTC 2 cut(s) 150, 230
Tru1I TTAA 1 cut(s) 92
Tru9I TTAA 1 cut(s) 92
TseFI GTSAC 1 cut(s) 156
Tsp45I GTSAC 1 cut(s) 156
TspGWI ACGGA 1 cut(s) 65
XagI CCTNNNNNAGG 1 cut(s) 195
XspI CTAG 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.