Rh6AG347300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
54783166 .. 54783475
310 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG347300.1

Sequence Viewer

Length: 189 bp
ATGCAATCACAGACTTCAACCAATATTGTTCATCAACCACAGCCACAAGATTCCTCCAATCCTGTATTCTCAGGGAGGAGATTCAAGTCACCAGCAAAAAGGATCAAACCAGGAAAGAAGCCTGCAGAAGGTTCTACTTCTGCCACAAACTCTGGGACTGATTCAAGAAAGCCCTCATGGAAGTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.8

Weight (kDa)

10.75

Isoelectric Point (pI)

71.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 110
AfiI CCNNNNNNNGG 1 cut(s) 128
AgsI TTSAA 3 cut(s) 18, 85, 165
AjnI CCWGG 1 cut(s) 109
AjuI GAANNNNNNNTTGG 2 cut(s) 50, 82
AlwI GGATC 1 cut(s) 110
AsuHPI GGTGA 1 cut(s) 81
BciT130I CCWGG 1 cut(s) 111
BfmI CTRYAG 1 cut(s) 123
Bme1390I CCNGG 1 cut(s) 111
BmrFI CCNGG 1 cut(s) 111
Bsc4I CCNNNNNNNGG 1 cut(s) 128
BseBI CCWGG 1 cut(s) 111
BseLI CCNNNNNNNGG 1 cut(s) 128
BseMII CTCAG 1 cut(s) 84
BseRI GAGGAG 1 cut(s) 91
BslFI GGGAC 1 cut(s) 169
BslI CCNNNNNNNGG 1 cut(s) 128
BsmFI GGGAC 1 cut(s) 169
Bsp143I GATC 1 cut(s) 102
BspCNI CTCAG 1 cut(s) 83
BspMAI CTGCAG 1 cut(s) 127
BspPI GGATC 1 cut(s) 110
BssMI GATC 1 cut(s) 102
Bst2UI CCWGG 1 cut(s) 111
BstC8I GCNNGC 1 cut(s) 123
BstDEI CTNAG 1 cut(s) 70
BstENI CCTNNNNNAGG 1 cut(s) 126
BstKTI GATC 1 cut(s) 105
BstMBI GATC 1 cut(s) 102
BstNI CCWGG 1 cut(s) 111
BstSCI CCNGG 1 cut(s) 109
BstSFI CTRYAG 1 cut(s) 123
Cac8I GCNNGC 1 cut(s) 123
CviAII CATG 1 cut(s) 177
CviJI RGCY 3 cut(s) 43, 121, 172
CviKI_1 RGCY 3 cut(s) 43, 121, 172
DdeI CTNAG 1 cut(s) 70
DpnI GATC 1 cut(s) 104
DpnII GATC 1 cut(s) 102
EcoNI CCTNNNNNAGG 1 cut(s) 126
EcoRII CCWGG 1 cut(s) 109
FaeI CATG 1 cut(s) 180
FaiI YATR 1 cut(s) 178
FaqI GGGAC 1 cut(s) 169
FatI CATG 1 cut(s) 176
Hin1II CATG 1 cut(s) 180
HinfI GANTC 3 cut(s) 50, 81, 161
HphI GGTGA 1 cut(s) 81
Hpy188III TCNNGA 1 cut(s) 165
HpyAV CCTTC 1 cut(s) 122
HpyCH4V TGCA 2 cut(s) 4, 125
HpyF3I CTNAG 1 cut(s) 70
Hsp92II CATG 1 cut(s) 180
Kzo9I GATC 1 cut(s) 102
LpnPI CCDG 7 cut(s) 57, 75, 96, 105, 123, 135, 138
MaeIII GTNAC 1 cut(s) 87
MalI GATC 1 cut(s) 104
MboI GATC 1 cut(s) 102
MnlI CCTC 3 cut(s) 64, 69, 184
MspR9I CCNGG 1 cut(s) 111
MvaI CCWGG 1 cut(s) 111
NdeII GATC 1 cut(s) 102
NlaIII CATG 1 cut(s) 180
NmuCI GTSAC 1 cut(s) 87
PfeI GAWTC 3 cut(s) 50, 81, 161
Psp6I CCWGG 1 cut(s) 109
PspGI CCWGG 1 cut(s) 109
PstI CTGCAG 1 cut(s) 127
Sau3AI GATC 1 cut(s) 102
ScrFI CCNGG 1 cut(s) 111
SetI ASST 1 cut(s) 133
SfcI CTRYAG 1 cut(s) 123
SspI AATATT 1 cut(s) 25
StyD4I CCNGG 1 cut(s) 109
TfiI GAWTC 3 cut(s) 50, 81, 161
TseFI GTSAC 1 cut(s) 87
Tsp45I GTSAC 1 cut(s) 87
TspDTI ATGAA 1 cut(s) 20
XagI CCTNNNNNAGG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.