Rh5DG243200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
27819994 .. 27825780
5787 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG243200.1

Sequence Viewer

Length: 186 bp
ATGGGGATCCACCTGTGTTTTCAGGAGGGGAATGTGGAGAATGAGCAAATGCAGGGGAATGGGGGAGCTGTGAATCAGCACCAGCAACCCCAAGCTCAAGGGAATGAGGGGGCTGTGAATCAGCACGAGCAGCAGCCCCATGCTCAAAATGTTGAAGCTCCTCAGAATCATCAACAACAACACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.76

Weight (kDa)

5.22

Isoelectric Point (pI)

37.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 14
AgsI TTSAA 1 cut(s) 155
AluBI AGCT 3 cut(s) 68, 95, 158
AluI AGCT 3 cut(s) 68, 95, 158
AlwI GGATC 1 cut(s) 14
ApeKI GCWGC 2 cut(s) 130, 133
BamHI GGATCC 1 cut(s) 6
BauI CACGAG 1 cut(s) 125
BbvI GCAGC 2 cut(s) 142, 145
BfaI CTAG 1 cut(s) 184
BisI GCNGC 2 cut(s) 131, 134
BlsI GCNGC 2 cut(s) 132, 135
BmiI GGNNCC 1 cut(s) 8
BpuEI CTTGAG 1 cut(s) 81
BseMII CTCAG 1 cut(s) 176
BseRI GAGGAG 1 cut(s) 150
BseXI GCAGC 2 cut(s) 142, 145
Bsp143I GATC 1 cut(s) 6
BspCNI CTCAG 1 cut(s) 175
BspLI GGNNCC 1 cut(s) 8
BspPI GGATC 1 cut(s) 14
BssMI GATC 1 cut(s) 6
BssSI CACGAG 1 cut(s) 125
Bst2BI CACGAG 1 cut(s) 125
BstDEI CTNAG 1 cut(s) 162
BstKTI GATC 1 cut(s) 9
BstMBI GATC 1 cut(s) 6
BstMWI GCNNNNNNNGC 1 cut(s) 130
BstV1I GCAGC 2 cut(s) 142, 145
BstX2I RGATCY 1 cut(s) 6
BstYI RGATCY 1 cut(s) 6
CviAII CATG 1 cut(s) 140
CviJI RGCY 5 cut(s) 68, 95, 113, 136, 158
CviKI_1 RGCY 5 cut(s) 68, 95, 113, 136, 158
DdeI CTNAG 1 cut(s) 162
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
FaeI CATG 1 cut(s) 143
FaiI YATR 1 cut(s) 141
FatI CATG 1 cut(s) 139
Fnu4HI GCNGC 2 cut(s) 131, 134
Fsp4HI GCNGC 2 cut(s) 131, 134
FspBI CTAG 1 cut(s) 184
GluI GCNGC 2 cut(s) 131, 134
Hin1II CATG 1 cut(s) 143
HinfI GANTC 3 cut(s) 73, 118, 166
Hpy188I TCNGA 1 cut(s) 165
Hpy188III TCNNGA 1 cut(s) 23
HpyCH4V TGCA 1 cut(s) 52
HpyF10VI GCNNNNNNNGC 1 cut(s) 130
HpyF3I CTNAG 1 cut(s) 162
Hsp92II CATG 1 cut(s) 143
Kzo9I GATC 1 cut(s) 6
LmnI GCTCC 2 cut(s) 65, 163
LpnPI CCDG 4 cut(s) 8, 26, 38, 95
Lsp1109I GCAGC 2 cut(s) 142, 145
MaeI CTAG 1 cut(s) 184
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MflI RGATCY 1 cut(s) 6
MnlI CCTC 3 cut(s) 19, 100, 171
MwoI GCNNNNNNNGC 1 cut(s) 130
NdeII GATC 1 cut(s) 6
NlaIII CATG 1 cut(s) 143
NlaIV GGNNCC 1 cut(s) 8
PfeI GAWTC 3 cut(s) 73, 118, 166
PkrI GCNGC 2 cut(s) 132, 135
PspN4I GGNNCC 1 cut(s) 8
PsuI RGATCY 1 cut(s) 6
SatI GCNGC 2 cut(s) 131, 134
Sau3AI GATC 1 cut(s) 6
SetI ASST 4 cut(s) 15, 70, 97, 160
SgeI CNNG 9 cut(s) 25, 35, 65, 94, 104, 110, 137, 139, 152
SmlI CTYRAG 1 cut(s) 96
SmoI CTYRAG 1 cut(s) 96
SspMI CTAG 1 cut(s) 184
TfiI GAWTC 3 cut(s) 73, 118, 166
TseI GCWGC 2 cut(s) 130, 133
XspI CTAG 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.