Rh4DG018300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0002555
Physical Location & Seq
Forward (+)
2877572 .. 2877949
378 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG018300.1

Sequence Viewer

Length: 249 bp
ATGGAGGATGTTGAGGTTCCAGCTCCTGCAGAGCCACCACAGGTTAATTCTGAGACTATTAGTGGACCTCTAAATGTTGATCACTTCAATGTAAATCAGCAACCTAGAGCCTCCTCCAGGCCTCTCTTTTCAGGAAAAAGGTTCAAATCCCCAGCAAGAAGAATCAAATTCCCAAAGAACCCTAGACAAGAGTCTACTTCTAGCACTGCCTCTAGAACTGGAAGTAAGAAGGCCAATTGGAAGTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.17

Weight (kDa)

10.43

Isoelectric Point (pI)

62.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 194
AcsI RAATTY 1 cut(s) 167
AfaI GTAC 1 cut(s) 245
AfiI CCNNNNNNNGG 1 cut(s) 117
AgsI TTSAA 2 cut(s) 88, 145
AjnI CCWGG 1 cut(s) 116
AluBI AGCT 1 cut(s) 23
AluI AGCT 1 cut(s) 23
Alw26I GTCTC 1 cut(s) 47
AlwNI CAGNNNCTG 1 cut(s) 26
AoxI GGCC 2 cut(s) 119, 231
ApoI RAATTY 1 cut(s) 167
AspS9I GGNCC 1 cut(s) 65
AvaII GGWCC 1 cut(s) 65
BciT130I CCWGG 1 cut(s) 118
BclI TGATCA 1 cut(s) 79
BcoDI GTCTC 1 cut(s) 47
BfaI CTAG 4 cut(s) 105, 183, 201, 213
BfmI CTRYAG 1 cut(s) 27
BmcAI AGTACT 1 cut(s) 245
Bme1390I CCNGG 1 cut(s) 118
Bme18I GGWCC 1 cut(s) 65
BmgT120I GGNCC 1 cut(s) 65
BmiI GGNNCC 1 cut(s) 18
BmrFI CCNGG 1 cut(s) 118
BoxI GACNNNNGTC 1 cut(s) 190
BpmI CTGGAG 1 cut(s) 100
Bsc4I CCNNNNNNNGG 1 cut(s) 117
Bse1I ACTGG 1 cut(s) 223
BseBI CCWGG 1 cut(s) 118
BseGI GGATG 1 cut(s) 13
BseLI CCNNNNNNNGG 1 cut(s) 117
BseMII CTCAG 1 cut(s) 42
BseNI ACTGG 1 cut(s) 223
BseRI GAGGAG 1 cut(s) 103
BseYI CCCAGC 1 cut(s) 151
BshFI GGCC 2 cut(s) 121, 233
BslI CCNNNNNNNGG 1 cut(s) 117
BsmAI GTCTC 1 cut(s) 47
BsnI GGCC 2 cut(s) 121, 233
Bsp143I GATC 1 cut(s) 79
BspANI GGCC 2 cut(s) 121, 233
BspCNI CTCAG 1 cut(s) 43
BspLI GGNNCC 1 cut(s) 18
BspMAI CTGCAG 1 cut(s) 31
BsrI ACTGG 1 cut(s) 223
BssMI GATC 1 cut(s) 79
Bst2UI CCWGG 1 cut(s) 118
BstDEI CTNAG 1 cut(s) 51
BstENI CCTNNNNNAGG 1 cut(s) 115
BstF5I GGATG 1 cut(s) 13
BstKTI GATC 1 cut(s) 82
BstMAI GTCTC 1 cut(s) 47
BstMBI GATC 1 cut(s) 79
BstNI CCWGG 1 cut(s) 118
BstPAI GACNNNNGTC 1 cut(s) 190
BstSCI CCNGG 1 cut(s) 116
BstSFI CTRYAG 1 cut(s) 27
BsuRI GGCC 2 cut(s) 121, 233
BtsCI GGATG 1 cut(s) 13
BtsI GCAGTG 1 cut(s) 204
BtsIMutI CAGTG 1 cut(s) 204
CaiI CAGNNNCTG 1 cut(s) 26
Cfr13I GGNCC 1 cut(s) 65
Csp6I GTAC 1 cut(s) 244
CviJI RGCY 5 cut(s) 23, 34, 110, 121, 233
CviKI_1 RGCY 5 cut(s) 23, 34, 110, 121, 233
CviQI GTAC 1 cut(s) 244
DdeI CTNAG 1 cut(s) 51
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
Eco147I AGGCCT 1 cut(s) 121
Eco47I GGWCC 1 cut(s) 65
EcoNI CCTNNNNNAGG 1 cut(s) 115
EcoRII CCWGG 1 cut(s) 116
FbaI TGATCA 1 cut(s) 79
FblI GTMKAC 1 cut(s) 194
FokI GGATG 1 cut(s) 20
FspBI CTAG 4 cut(s) 105, 183, 201, 213
GsaI CCCAGC 1 cut(s) 155
GsuI CTGGAG 1 cut(s) 100
HaeIII GGCC 2 cut(s) 121, 233
HinfI GANTC 2 cut(s) 162, 191
Hpy166II GTNNAC 2 cut(s) 65, 195
Hpy188I TCNGA 1 cut(s) 52
Hpy188III TCNNGA 2 cut(s) 132, 213
Hpy8I GTNNAC 2 cut(s) 65, 195
HpyAV CCTTC 1 cut(s) 223
HpyCH4V TGCA 1 cut(s) 29
HpyF3I CTNAG 1 cut(s) 51
Ksp22I TGATCA 1 cut(s) 79
Kzo9I GATC 1 cut(s) 79
LmnI GCTCC 1 cut(s) 28
LpnPI CCDG 8 cut(s) 26, 33, 39, 103, 117, 130, 165, 204
MaeI CTAG 4 cut(s) 105, 183, 201, 213
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MboII GAAGA 1 cut(s) 171
MfeI CAATTG 1 cut(s) 235
MluCI AATT 3 cut(s) 46, 167, 235
MlyI GAGTC 1 cut(s) 200
MnlI CCTC 6 cut(s) 7, 78, 121, 124, 132, 220
MseI TTAA 1 cut(s) 45
MslI CAYNNNNRTG 1 cut(s) 87
MspR9I CCNGG 1 cut(s) 118
MunI CAATTG 1 cut(s) 235
MvaI CCWGG 1 cut(s) 118
NdeII GATC 1 cut(s) 79
NlaIV GGNNCC 1 cut(s) 18
PceI AGGCCT 1 cut(s) 121
PfeI GAWTC 1 cut(s) 162
PleI GAGTC 1 cut(s) 199
PpsI GAGTC 1 cut(s) 199
PshAI GACNNNNGTC 1 cut(s) 190
Psp6I CCWGG 1 cut(s) 116
PspFI CCCAGC 1 cut(s) 151
PspGI CCWGG 1 cut(s) 116
PspN4I GGNNCC 1 cut(s) 18
PspPI GGNCC 1 cut(s) 65
PstI CTGCAG 1 cut(s) 31
PstNI CAGNNNCTG 1 cut(s) 26
RsaI GTAC 1 cut(s) 245
RsaNI GTAC 1 cut(s) 244
RseI CAYNNNNRTG 1 cut(s) 87
SaqAI TTAA 1 cut(s) 45
Sau3AI GATC 1 cut(s) 79
Sau96I GGNCC 1 cut(s) 65
ScaI AGTACT 1 cut(s) 245
SchI GAGTC 1 cut(s) 200
ScrFI CCNGG 1 cut(s) 118
SetI ASST 6 cut(s) 18, 25, 45, 70, 106, 143
SfcI CTRYAG 1 cut(s) 27
SinI GGWCC 1 cut(s) 65
SmiMI CAYNNNNRTG 1 cut(s) 87
Sse9I AATT 3 cut(s) 46, 167, 235
SseBI AGGCCT 1 cut(s) 121
SspMI CTAG 4 cut(s) 105, 183, 201, 213
StuI AGGCCT 1 cut(s) 121
StyD4I CCNGG 1 cut(s) 116
TasI AATT 3 cut(s) 46, 167, 235
TatI WGTACW 1 cut(s) 243
TfiI GAWTC 1 cut(s) 162
Tru1I TTAA 1 cut(s) 45
Tru9I TTAA 1 cut(s) 45
TscAI CASTG 1 cut(s) 211
TspRI CASTG 1 cut(s) 211
VpaK11BI GGWCC 1 cut(s) 65
XagI CCTNNNNNAGG 1 cut(s) 115
XapI RAATTY 1 cut(s) 167
XbaI TCTAGA 1 cut(s) 212
XmiI GTMKAC 1 cut(s) 194
XspI CTAG 4 cut(s) 105, 183, 201, 213
ZrmI AGTACT 1 cut(s) 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.