Rh3DG253400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
25000894 .. 25004627
3734 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG253400.1

Sequence Viewer

Length: 210 bp
ATGGCCAATTATTGGAGATACTTTAGACTTGATGGGGATCCAATAAGACAAGAAGATTCTGGTACTCAAAACCCAAATATCAGAGATGAAGTTCCAAATCAGCATACTCAACCCCACCCTGAGAACTTGGGCATGAATGTCAATGAGGATACAAATTTGAATATGAATGTGGGAGGCACCTTTAAAATGATGCATGGTGCCAAAGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.91

Weight (kDa)

5.39

Isoelectric Point (pI)

35.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 176, 197
AccB7I CCANNNNNTGG 1 cut(s) 12
AclWI GGATC 2 cut(s) 32, 45
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 154
AfaI GTAC 1 cut(s) 64
AfiI CCNNNNNNNGG 1 cut(s) 12
AgsI TTSAA 1 cut(s) 160
AluBI AGCT 1 cut(s) 206
AluI AGCT 1 cut(s) 206
AlwI GGATC 2 cut(s) 32, 45
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 154
BalI TGGCCA 1 cut(s) 5
BamHI GGATCC 1 cut(s) 37
BanI GGYRCC 2 cut(s) 176, 197
BccI CCATC 1 cut(s) 26
BciVI GTATCC 1 cut(s) 142
BfuI GTATCC 1 cut(s) 142
BmiI GGNNCC 3 cut(s) 39, 178, 199
BmsI GCATC 1 cut(s) 180
BsaBI GATNNNNATC 1 cut(s) 36
Bsc4I CCNNNNNNNGG 1 cut(s) 12
Bse8I GATNNNNATC 1 cut(s) 36
BseJI GATNNNNATC 1 cut(s) 36
BseLI CCNNNNNNNGG 1 cut(s) 12
BseMII CTCAG 1 cut(s) 111
BshFI GGCC 1 cut(s) 5
BshNI GGYRCC 2 cut(s) 176, 197
BslI CCNNNNNNNGG 1 cut(s) 12
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 37
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 112
BspLI GGNNCC 3 cut(s) 39, 178, 199
BspPI GGATC 2 cut(s) 32, 45
BspT107I GGYRCC 2 cut(s) 176, 197
BssMI GATC 1 cut(s) 37
BstDEI CTNAG 2 cut(s) 120, 207
BstKTI GATC 1 cut(s) 40
BstMBI GATC 1 cut(s) 37
BstX2I RGATCY 1 cut(s) 37
BstYI RGATCY 1 cut(s) 37
BsuI GTATCC 1 cut(s) 142
BsuRI GGCC 1 cut(s) 5
Csp6I GTAC 1 cut(s) 63
CviAII CATG 2 cut(s) 133, 194
CviJI RGCY 2 cut(s) 5, 206
CviKI_1 RGCY 2 cut(s) 5, 206
CviQI GTAC 1 cut(s) 63
DdeI CTNAG 2 cut(s) 120, 207
DpnI GATC 1 cut(s) 39
DpnII GATC 1 cut(s) 37
DraI TTTAAA 1 cut(s) 184
EaeI YGGCCR 1 cut(s) 3
EcoT22I ATGCAT 1 cut(s) 195
FaeI CATG 2 cut(s) 136, 197
FaiI YATR 4 cut(s) 105, 134, 164, 195
FatI CATG 2 cut(s) 132, 193
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 2 cut(s) 136, 197
HindIII AAGCTT 1 cut(s) 204
HinfI GANTC 1 cut(s) 56
Hpy188I TCNGA 1 cut(s) 83
HpyCH4V TGCA 1 cut(s) 193
HpyF3I CTNAG 2 cut(s) 120, 207
Hsp92II CATG 2 cut(s) 136, 197
Kzo9I GATC 1 cut(s) 37
LpnPI CCDG 2 cut(s) 45, 132
LweI GCATC 1 cut(s) 180
MalI GATC 1 cut(s) 39
MboI GATC 1 cut(s) 37
MboII GAAGA 1 cut(s) 65
MflI RGATCY 1 cut(s) 37
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 7, 154
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 2 cut(s) 139, 167
Mox20I TGGCCA 1 cut(s) 5
Mph1103I ATGCAT 1 cut(s) 195
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 183
Msp20I TGGCCA 1 cut(s) 5
NdeII GATC 1 cut(s) 37
NlaIII CATG 2 cut(s) 136, 197
NlaIV GGNNCC 3 cut(s) 39, 178, 199
NsiI ATGCAT 1 cut(s) 195
PfeI GAWTC 1 cut(s) 56
PflMI CCANNNNNTGG 1 cut(s) 12
PspN4I GGNNCC 3 cut(s) 39, 178, 199
PsuI RGATCY 1 cut(s) 37
RsaI GTAC 1 cut(s) 64
RsaNI GTAC 1 cut(s) 63
SaqAI TTAA 1 cut(s) 183
Sau3AI GATC 1 cut(s) 37
SetI ASST 2 cut(s) 182, 208
SfaNI GCATC 1 cut(s) 180
SgeI CNNG 7 cut(s) 41, 62, 72, 131, 139, 145, 206
Sse9I AATT 2 cut(s) 7, 154
TasI AATT 2 cut(s) 7, 154
TfiI GAWTC 1 cut(s) 56
Tru1I TTAA 1 cut(s) 183
Tru9I TTAA 1 cut(s) 183
TspDTI ATGAA 3 cut(s) 102, 149, 179
Van91I CCANNNNNTGG 1 cut(s) 12
XapI RAATTY 1 cut(s) 154
Zsp2I ATGCAT 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.