Rroxscaffold_5G00351740

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
28274924 .. 28289756
14833 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00351740.1

Sequence Viewer

Length: 369 bp
ATGCAGATAATTCCTTCATCACTGTCCTTCCGCAAGATAATATTGGTGGTCTTCAAGTCCTTCAACATAACATGTGGATTGATGAAAAGCACATTATGTGCCTTCGTCAAAGAAACAGACGAAGAGGGAATCAAGCAATTACAAATCACAGCTCAATCGGCATTTAACTTGGAAATAGAAGCAGTTGAAGATTGTGAAGATGGTGATGCTGATCCACGAAAAGACTTGGAAGTAGAAGCAGTTGAAGAGGACGGGAGCTTTAAAATTGATGCCAACAACTACGACATCTATGGACCTCTCTTCGAGAAAGCGTACGCCGGGAATTGGAAAGCTATAACGGAGTTCATTATCCAACATCCCGAGGCGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

122

Amino Acids

13.7

Weight (kDa)

4.34

Isoelectric Point (pI)

38.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 31
AclWI GGATC 1 cut(s) 206
AfaI GTAC 1 cut(s) 314
AfiI CCNNNNNNNGG 1 cut(s) 324
AflIII ACRYGT 1 cut(s) 71
AgsI TTSAA 4 cut(s) 55, 64, 188, 245
AluBI AGCT 3 cut(s) 152, 258, 332
AluI AGCT 3 cut(s) 152, 258, 332
AlwI GGATC 1 cut(s) 206
Ama87I CYCGRG 1 cut(s) 359
AspS9I GGNCC 1 cut(s) 293
AsuC2I CCSGG 1 cut(s) 319
AsuHPI GGTGA 1 cut(s) 215
AvaI CYCGRG 1 cut(s) 359
AvaII GGWCC 1 cut(s) 293
BbsI GAAGAC 1 cut(s) 43
BccI CCATC 1 cut(s) 194
BcnI CCSGG 1 cut(s) 319
Bme1390I CCNGG 1 cut(s) 319
Bme18I GGWCC 1 cut(s) 293
BmeT110I CYCGRG 1 cut(s) 359
BmgT120I GGNCC 1 cut(s) 293
BmrFI CCNGG 1 cut(s) 319
BmsI GCATC 2 cut(s) 196, 259
BpiI GAAGAC 1 cut(s) 43
BpuMI CCSGG 1 cut(s) 319
BsaBI GATNNNNATC 1 cut(s) 210
BsaJI CCNNGG 1 cut(s) 360
Bsc4I CCNNNNNNNGG 1 cut(s) 324
Bse8I GATNNNNATC 1 cut(s) 210
BseDI CCNNGG 1 cut(s) 360
BseGI GGATG 1 cut(s) 355
BseJI GATNNNNATC 1 cut(s) 210
BseLI CCNNNNNNNGG 1 cut(s) 324
BsiHKCI CYCGRG 1 cut(s) 359
BsiSI CCGG 1 cut(s) 318
BsiWI CGTACG 1 cut(s) 312
BslI CCNNNNNNNGG 1 cut(s) 324
BsoBI CYCGRG 1 cut(s) 359
Bsp143I GATC 1 cut(s) 211
BspACI CCGC 1 cut(s) 31
BspPI GGATC 1 cut(s) 206
BssECI CCNNGG 1 cut(s) 360
BssMI GATC 1 cut(s) 211
Bst4CI ACNGT 1 cut(s) 24
Bst6I CTCTTC 3 cut(s) 117, 240, 305
BstF5I GGATG 1 cut(s) 355
BstKTI GATC 1 cut(s) 214
BstMBI GATC 1 cut(s) 211
BstMWI GCNNNNNNNGC 1 cut(s) 158
BstNSI RCATGY 1 cut(s) 75
BstSCI CCNGG 1 cut(s) 317
BstV2I GAAGAC 1 cut(s) 43
BtsCI GGATG 1 cut(s) 355
BtsIMutI CAGTG 1 cut(s) 20
Cfr13I GGNCC 1 cut(s) 293
Csp6I GTAC 1 cut(s) 313
CviAII CATG 1 cut(s) 72
CviJI RGCY 3 cut(s) 152, 258, 332
CviKI_1 RGCY 3 cut(s) 152, 258, 332
CviQI GTAC 1 cut(s) 313
DpnI GATC 1 cut(s) 213
DpnII GATC 1 cut(s) 211
DraI TTTAAA 1 cut(s) 262
Eam1104I CTCTTC 3 cut(s) 117, 240, 305
EarI CTCTTC 3 cut(s) 117, 240, 305
Eco47I GGWCC 1 cut(s) 293
Eco88I CYCGRG 1 cut(s) 359
FaeI CATG 1 cut(s) 75
FaiI YATR 5 cut(s) 68, 73, 97, 291, 335
FatI CATG 1 cut(s) 71
FokI GGATG 1 cut(s) 342
HapII CCGG 1 cut(s) 318
Hin1II CATG 1 cut(s) 75
HinfI GANTC 1 cut(s) 129
HpaII CCGG 1 cut(s) 318
HphI GGTGA 1 cut(s) 215
Hpy188III TCNNGA 2 cut(s) 304, 359
HpyAV CCTTC 4 cut(s) 24, 37, 70, 112
HpyCH4III ACNGT 1 cut(s) 24
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 158
Hsp92II CATG 1 cut(s) 75
Kzo9I GATC 1 cut(s) 211
LmnI GCTCC 1 cut(s) 255
LpnPI CCDG 1 cut(s) 331
LweI GCATC 2 cut(s) 196, 259
MalI GATC 1 cut(s) 213
MboI GATC 1 cut(s) 211
MboII GAAGA 6 cut(s) 43, 134, 200, 209, 257, 292
MluCI AATT 4 cut(s) 9, 137, 264, 322
MnlI CCTC 4 cut(s) 118, 241, 306, 355
MseI TTAA 2 cut(s) 165, 261
MspI CCGG 1 cut(s) 318
MspR9I CCNGG 1 cut(s) 319
MwoI GCNNNNNNNGC 1 cut(s) 158
NciI CCSGG 1 cut(s) 319
NdeII GATC 1 cut(s) 211
NlaIII CATG 1 cut(s) 75
NspI RCATGY 1 cut(s) 75
PciI ACATGT 1 cut(s) 71
PfeI GAWTC 1 cut(s) 129
Pfl23II CGTACG 1 cut(s) 312
PscI ACATGT 1 cut(s) 71
PspLI CGTACG 1 cut(s) 312
PspPI GGNCC 1 cut(s) 293
RsaI GTAC 1 cut(s) 314
RsaNI GTAC 1 cut(s) 313
SaqAI TTAA 2 cut(s) 165, 261
Sau3AI GATC 1 cut(s) 211
Sau96I GGNCC 1 cut(s) 293
ScrFI CCNGG 1 cut(s) 319
SetI ASST 4 cut(s) 154, 260, 298, 334
SfaNI GCATC 2 cut(s) 196, 259
SinI GGWCC 1 cut(s) 293
Sse9I AATT 4 cut(s) 9, 137, 264, 322
SsiI CCGC 1 cut(s) 31
SspI AATATT 1 cut(s) 42
StyD4I CCNGG 1 cut(s) 317
TaaI ACNGT 1 cut(s) 24
TaqI TCGA 1 cut(s) 303
TasI AATT 4 cut(s) 9, 137, 264, 322
TfiI GAWTC 1 cut(s) 129
Tru1I TTAA 2 cut(s) 165, 261
Tru9I TTAA 2 cut(s) 165, 261
TscAI CASTG 1 cut(s) 27
TspDTI ATGAA 3 cut(s) 6, 98, 334
TspGWI ACGGA 1 cut(s) 353
TspRI CASTG 1 cut(s) 27
VpaK11BI GGWCC 1 cut(s) 293
XceI RCATGY 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.