Rroxscaffold_6G00408610

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
OG0001508
Physical Location & Seq
Reverse (-)
31097184 .. 31108528
11345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00408610.1

Sequence Viewer

Length: 222 bp
ATGTGCCTTCGTCAAAAAACAGACAAAGAGGGAATCAAGCAATTACAAATCACAGCTCAATTAGCATTTAGTACCATCAATATGTGTGGATACCCAGGAAAGAGAGTTAGCTTTCGTCAAAAATCAGGGCTGACATGTAGCGATTCCTCCTCTGTTTCTTCCACCAAGACCAAGGCGGGCTTGTATTTGTGCAAGTCTAATAATTATATTAGTATTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.03

Weight (kDa)

9.55

Isoelectric Point (pI)

39.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 176
AfaI GTAC 1 cut(s) 73
AflIII ACRYGT 1 cut(s) 134
AjnI CCWGG 1 cut(s) 94
AluBI AGCT 2 cut(s) 56, 111
AluI AGCT 2 cut(s) 56, 111
BccI CCATC 1 cut(s) 83
BciT130I CCWGG 1 cut(s) 96
BciVI GTATCC 1 cut(s) 83
BfuI GTATCC 1 cut(s) 83
Bme1390I CCNGG 1 cut(s) 96
BmrFI CCNGG 1 cut(s) 96
BsaJI CCNNGG 2 cut(s) 94, 171
BseBI CCWGG 1 cut(s) 96
BseDI CCNNGG 2 cut(s) 94, 171
BseRI GAGGAG 1 cut(s) 139
BspACI CCGC 1 cut(s) 176
BssECI CCNNGG 2 cut(s) 94, 171
BssT1I CCWWGG 1 cut(s) 171
Bst2UI CCWGG 1 cut(s) 96
BstC8I GCNNGC 1 cut(s) 178
BstMWI GCNNNNNNNGC 1 cut(s) 62
BstNI CCWGG 1 cut(s) 96
BstNSI RCATGY 1 cut(s) 138
BstSCI CCNGG 1 cut(s) 94
BsuI GTATCC 1 cut(s) 83
Cac8I GCNNGC 1 cut(s) 178
Csp6I GTAC 1 cut(s) 72
CspCI CAANNNNNGTGG 2 cut(s) 67, 102
CviAII CATG 1 cut(s) 135
CviJI RGCY 4 cut(s) 56, 111, 130, 180
CviKI_1 RGCY 4 cut(s) 56, 111, 130, 180
CviQI GTAC 1 cut(s) 72
Eco130I CCWWGG 1 cut(s) 171
EcoRII CCWGG 1 cut(s) 94
EcoT14I CCWWGG 1 cut(s) 171
ErhI CCWWGG 1 cut(s) 171
FaeI CATG 1 cut(s) 138
FaiI YATR 3 cut(s) 83, 136, 207
FalI AAGNNNNNCTT 2 cut(s) 164, 196
FatI CATG 1 cut(s) 134
FauI CCCGC 1 cut(s) 169
Hin1II CATG 1 cut(s) 138
HinfI GANTC 2 cut(s) 33, 143
HpyAV CCTTC 1 cut(s) 17
HpyCH4V TGCA 1 cut(s) 192
HpyF10VI GCNNNNNNNGC 1 cut(s) 62
Hsp92II CATG 1 cut(s) 138
LpnPI CCDG 3 cut(s) 81, 108, 111
MboII GAAGA 1 cut(s) 150
MluCI AATT 3 cut(s) 41, 59, 202
MnlI CCTC 3 cut(s) 22, 157, 160
MslI CAYNNNNRTG 1 cut(s) 80
MspR9I CCNGG 1 cut(s) 96
MvaI CCWGG 1 cut(s) 96
MwoI GCNNNNNNNGC 1 cut(s) 62
NlaIII CATG 1 cut(s) 138
NspI RCATGY 1 cut(s) 138
PciI ACATGT 1 cut(s) 134
PfeI GAWTC 2 cut(s) 33, 143
PscI ACATGT 1 cut(s) 134
Psp6I CCWGG 1 cut(s) 94
PspGI CCWGG 1 cut(s) 94
RsaI GTAC 1 cut(s) 73
RsaNI GTAC 1 cut(s) 72
RseI CAYNNNNRTG 1 cut(s) 80
ScrFI CCNGG 1 cut(s) 96
SetI ASST 2 cut(s) 58, 113
SmiMI CAYNNNNRTG 1 cut(s) 80
Sse9I AATT 3 cut(s) 41, 59, 202
SsiI CCGC 1 cut(s) 176
StyD4I CCNGG 1 cut(s) 94
StyI CCWWGG 1 cut(s) 171
TasI AATT 3 cut(s) 41, 59, 202
TfiI GAWTC 2 cut(s) 33, 143
XceI RCATGY 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.