Rh6DG097100

ATP-dependent RNA helicase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
12183754 .. 12188728
4975 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG097100.1

Sequence Viewer

Length: 168 bp
ATGGACCTGTTGGGAGTGGCGGGAAGGCGTCCTTGTCTTCCAATGGTGGTCTGCTACAGCTCACGTGACGAGATCGACGTCGTCAGCTCCACCGTCGCAACCGTCCCCTATATCTCTTTAGCCCCTCTGTTGGATACCTTCAATTTAGAAATACTGAAGAGGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.05

Weight (kDa)

4.93

Isoelectric Point (pI)

59.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 81
AciI CCGC 1 cut(s) 20
AcvI CACGTG 1 cut(s) 65
AcyI GRCGYC 2 cut(s) 28, 78
AfiI CCNNNNNNNGG 1 cut(s) 130
AgsI TTSAA 1 cut(s) 142
AluBI AGCT 2 cut(s) 60, 87
AluI AGCT 2 cut(s) 60, 87
AspS9I GGNCC 1 cut(s) 4
AvaII GGWCC 1 cut(s) 4
BbrPI CACGTG 1 cut(s) 65
BbsI GAAGAC 1 cut(s) 29
BciVI GTATCC 1 cut(s) 127
BfmI CTRYAG 1 cut(s) 55
BfuI GTATCC 1 cut(s) 127
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BpiI GAAGAC 1 cut(s) 29
BsaAI YACGTR 1 cut(s) 65
BsaHI GRCGYC 2 cut(s) 28, 78
Bsc4I CCNNNNNNNGG 1 cut(s) 130
BseLI CCNNNNNNNGG 1 cut(s) 130
BslFI GGGAC 1 cut(s) 89
BslI CCNNNNNNNGG 1 cut(s) 130
BsmFI GGGAC 1 cut(s) 89
Bsp143I GATC 1 cut(s) 72
BspACI CCGC 1 cut(s) 20
BssMI GATC 1 cut(s) 72
BssNI GRCGYC 2 cut(s) 28, 78
Bst4CI ACNGT 2 cut(s) 94, 103
Bst6I CTCTTC 1 cut(s) 152
BstACI GRCGYC 2 cut(s) 28, 78
BstBAI YACGTR 1 cut(s) 65
BstKTI GATC 1 cut(s) 75
BstMBI GATC 1 cut(s) 72
BstSFI CTRYAG 1 cut(s) 55
BstV2I GAAGAC 1 cut(s) 29
BsuI GTATCC 1 cut(s) 127
Cfr13I GGNCC 1 cut(s) 4
CseI GACGC 1 cut(s) 17
CviJI RGCY 3 cut(s) 60, 87, 122
CviKI_1 RGCY 3 cut(s) 60, 87, 122
DpnI GATC 1 cut(s) 74
DpnII GATC 1 cut(s) 72
Eam1104I CTCTTC 1 cut(s) 152
EarI CTCTTC 1 cut(s) 152
Eco47I GGWCC 1 cut(s) 4
Eco72I CACGTG 1 cut(s) 65
FaiI YATR 1 cut(s) 111
FalI AAGNNNNNCTT 2 cut(s) 16, 48
FaqI GGGAC 1 cut(s) 89
FauI CCCGC 1 cut(s) 13
HgaI GACGC 1 cut(s) 17
Hin1I GRCGYC 2 cut(s) 28, 78
Hpy99I CGWCG 3 cut(s) 80, 83, 98
HpyAV CCTTC 2 cut(s) 18, 148
HpyCH4III ACNGT 2 cut(s) 94, 103
HpyCH4IV ACGT 2 cut(s) 64, 78
HpySE526I ACGT 2 cut(s) 64, 78
Hsp92I GRCGYC 2 cut(s) 28, 78
Kzo9I GATC 1 cut(s) 72
LmnI GCTCC 1 cut(s) 92
LpnPI CCDG 1 cut(s) 20
MaeII ACGT 2 cut(s) 64, 78
MaeIII GTNAC 1 cut(s) 65
MalI GATC 1 cut(s) 74
MboI GATC 1 cut(s) 72
MboII GAAGA 1 cut(s) 29
MluCI AATT 1 cut(s) 142
MmeI TCCRAC 1 cut(s) 111
MnlI CCTC 2 cut(s) 135, 153
NdeII GATC 1 cut(s) 72
NmuCI GTSAC 1 cut(s) 65
PcsI WCGNNNNNNNCGW 1 cut(s) 75
PflFI GACNNNGTC 1 cut(s) 80
PmaCI CACGTG 1 cut(s) 65
PmlI CACGTG 1 cut(s) 65
Ppu21I YACGTR 1 cut(s) 65
PspCI CACGTG 1 cut(s) 65
PspPI GGNCC 1 cut(s) 4
PsyI GACNNNGTC 1 cut(s) 80
Sau3AI GATC 1 cut(s) 72
Sau96I GGNCC 1 cut(s) 4
SetI ASST 6 cut(s) 9, 62, 67, 81, 89, 140
SfcI CTRYAG 1 cut(s) 55
SgeI CNNG 6 cut(s) 19, 33, 45, 75, 77, 82
SinI GGWCC 1 cut(s) 4
Sse9I AATT 1 cut(s) 142
SsiI CCGC 1 cut(s) 20
TaaI ACNGT 2 cut(s) 94, 103
TaiI ACGT 2 cut(s) 67, 81
TaqI TCGA 1 cut(s) 75
TasI AATT 1 cut(s) 142
TseFI GTSAC 1 cut(s) 65
Tsp45I GTSAC 1 cut(s) 65
Tth111I GACNNNGTC 1 cut(s) 80
VpaK11BI GGWCC 1 cut(s) 4
ZraI GACGTC 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.