Rh2DG116300

Ribosomal protein S24e family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
9597683 .. 9598950
1268 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG116300.1

Sequence Viewer

Length: 207 bp
ATGGCAACAGTTGACCAATTTTTTCAAAACCCAAGCAGAGGTGTGGTGTATAGGAAGTTGCTTGGGACTTCGAGGAAAACATTGAAGATCGACATTGTGAACTTGCTGGAAGGCTTTAATTTGACTCTGGAAGATGTTAAAGTTCAGTACAATGGGCCTTTTGTGTTGTCTAGGTTGATACAAATAGAAAAGCTTATGTCTGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.79

Weight (kDa)

9.6

Isoelectric Point (pI)

20.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 149
AfiI CCNNNNNNNGG 1 cut(s) 38
AgsI TTSAA 2 cut(s) 26, 85
AluBI AGCT 1 cut(s) 193
AluI AGCT 1 cut(s) 193
AoxI GGCC 1 cut(s) 155
AspS9I GGNCC 1 cut(s) 155
BfaI CTAG 1 cut(s) 171
BmgT120I GGNCC 1 cut(s) 155
Bsc4I CCNNNNNNNGG 1 cut(s) 38
BseLI CCNNNNNNNGG 1 cut(s) 38
BshFI GGCC 1 cut(s) 157
BslFI GGGAC 1 cut(s) 79
BslI CCNNNNNNNGG 1 cut(s) 38
BsmFI GGGAC 1 cut(s) 79
BsnI GGCC 1 cut(s) 157
Bsp143I GATC 1 cut(s) 87
BspANI GGCC 1 cut(s) 157
BssMI GATC 1 cut(s) 87
Bst4CI ACNGT 1 cut(s) 10
BstKTI GATC 1 cut(s) 90
BstMBI GATC 1 cut(s) 87
BsuRI GGCC 1 cut(s) 157
Cfr13I GGNCC 1 cut(s) 155
Csp6I GTAC 1 cut(s) 148
CviJI RGCY 3 cut(s) 114, 157, 193
CviKI_1 RGCY 3 cut(s) 114, 157, 193
CviQI GTAC 1 cut(s) 148
DpnI GATC 1 cut(s) 89
DpnII GATC 1 cut(s) 87
FaiI YATR 2 cut(s) 51, 197
FaqI GGGAC 1 cut(s) 79
FspBI CTAG 1 cut(s) 171
HaeIII GGCC 1 cut(s) 157
HincII GTYRAC 1 cut(s) 13
HindII GTYRAC 1 cut(s) 13
HindIII AAGCTT 1 cut(s) 191
HinfI GANTC 1 cut(s) 124
Hpy166II GTNNAC 2 cut(s) 13, 100
Hpy188III TCNNGA 1 cut(s) 128
Hpy8I GTNNAC 2 cut(s) 13, 100
HpyAV CCTTC 1 cut(s) 104
HpyCH4III ACNGT 1 cut(s) 10
Kzo9I GATC 1 cut(s) 87
LpnPI CCDG 2 cut(s) 92, 113
MaeI CTAG 1 cut(s) 171
MalI GATC 1 cut(s) 89
MboI GATC 1 cut(s) 87
MboII GAAGA 2 cut(s) 97, 143
MluCI AATT 2 cut(s) 17, 118
MlyI GAGTC 1 cut(s) 118
MnlI CCTC 2 cut(s) 32, 66
MseI TTAA 2 cut(s) 117, 138
NdeII GATC 1 cut(s) 87
PleI GAGTC 1 cut(s) 118
PpsI GAGTC 1 cut(s) 118
PspPI GGNCC 1 cut(s) 155
RsaI GTAC 1 cut(s) 149
RsaNI GTAC 1 cut(s) 148
SaqAI TTAA 2 cut(s) 117, 138
Sau3AI GATC 1 cut(s) 87
Sau96I GGNCC 1 cut(s) 155
SchI GAGTC 1 cut(s) 118
SetI ASST 3 cut(s) 43, 176, 195
SgeI CNNG 7 cut(s) 45, 74, 84, 115, 119, 140, 183
Sse9I AATT 2 cut(s) 17, 118
SspMI CTAG 1 cut(s) 171
TaaI ACNGT 1 cut(s) 10
TaqI TCGA 2 cut(s) 71, 90
TasI AATT 2 cut(s) 17, 118
TatI WGTACW 1 cut(s) 147
Tru1I TTAA 2 cut(s) 117, 138
Tru9I TTAA 2 cut(s) 117, 138
XspI CTAG 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.