Rh7BG447500

Ribosomal protein S24e family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
52263039 .. 52265052
2014 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG447500.1

Sequence Viewer

Length: 258 bp
ATGTGGTATGTAACTGAAATTATAGGTGTGGTGTATAGGAAGTTGCTTGGGACTTTGAGGAAAACATTGAAGACCGACATTGTGAACTTGCTAGAAGGCTTTAATTTGACTCTGGAAGATGTTAAAGTTCAGTACAATGGGCCTTTTGTGTTGTCTAGATTGATATGGTTCAGAATAGCCTATGCATGTGTAGTGAGGCAGTATTCCGGTGCTGAAAACAGAAAGCTACGCTATGACTTAAGCAAATTAAGGTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

10.02

Weight (kDa)

9.86

Isoelectric Point (pI)

28.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 134
AflII CTTAAG 1 cut(s) 238
AgsI TTSAA 1 cut(s) 70
AluBI AGCT 1 cut(s) 226
AluI AGCT 1 cut(s) 226
AoxI GGCC 1 cut(s) 140
AspS9I GGNCC 1 cut(s) 140
BbsI GAAGAC 1 cut(s) 77
BfaI CTAG 2 cut(s) 92, 156
BfrI CTTAAG 1 cut(s) 238
BmgT120I GGNCC 1 cut(s) 140
BpiI GAAGAC 1 cut(s) 77
BsaWI WCCGGW 1 cut(s) 206
BshFI GGCC 1 cut(s) 142
BsiSI CCGG 1 cut(s) 207
BslFI GGGAC 1 cut(s) 64
BsmFI GGGAC 1 cut(s) 64
BsnI GGCC 1 cut(s) 142
BspANI GGCC 1 cut(s) 142
BspTI CTTAAG 1 cut(s) 238
BstAFI CTTAAG 1 cut(s) 238
BstNSI RCATGY 1 cut(s) 189
BstV2I GAAGAC 1 cut(s) 77
BsuRI GGCC 1 cut(s) 142
Cfr13I GGNCC 1 cut(s) 140
Csp6I GTAC 1 cut(s) 133
CviAII CATG 1 cut(s) 186
CviJI RGCY 4 cut(s) 99, 142, 179, 226
CviKI_1 RGCY 4 cut(s) 99, 142, 179, 226
CviQI GTAC 1 cut(s) 133
EcoT22I ATGCAT 1 cut(s) 187
FaeI CATG 1 cut(s) 189
FaiI YATR 8 cut(s) 9, 23, 36, 166, 183, 187, 234, 256
FaqI GGGAC 1 cut(s) 64
FatI CATG 1 cut(s) 185
FspBI CTAG 2 cut(s) 92, 156
HaeIII GGCC 1 cut(s) 142
HapII CCGG 1 cut(s) 207
Hin1II CATG 1 cut(s) 189
HinfI GANTC 1 cut(s) 109
HpaII CCGG 1 cut(s) 207
Hpy166II GTNNAC 1 cut(s) 85
Hpy188I TCNGA 1 cut(s) 173
Hpy188III TCNNGA 2 cut(s) 113, 156
Hpy8I GTNNAC 1 cut(s) 85
HpyAV CCTTC 1 cut(s) 89
HpyCH4V TGCA 1 cut(s) 185
Hsp92II CATG 1 cut(s) 189
LpnPI CCDG 2 cut(s) 98, 220
MaeI CTAG 2 cut(s) 92, 156
MaeIII GTNAC 1 cut(s) 10
MboII GAAGA 2 cut(s) 82, 128
MluCI AATT 3 cut(s) 18, 103, 245
MlyI GAGTC 1 cut(s) 103
MnlI CCTC 2 cut(s) 51, 189
Mph1103I ATGCAT 1 cut(s) 187
MseI TTAA 4 cut(s) 102, 123, 239, 248
MspCI CTTAAG 1 cut(s) 238
MspI CCGG 1 cut(s) 207
NlaIII CATG 1 cut(s) 189
NsiI ATGCAT 1 cut(s) 187
NspI RCATGY 1 cut(s) 189
PleI GAGTC 1 cut(s) 103
PpsI GAGTC 1 cut(s) 103
PspPI GGNCC 1 cut(s) 140
RsaI GTAC 1 cut(s) 134
RsaNI GTAC 1 cut(s) 133
SaqAI TTAA 4 cut(s) 102, 123, 239, 248
Sau96I GGNCC 1 cut(s) 140
SchI GAGTC 1 cut(s) 103
SetI ASST 3 cut(s) 28, 228, 254
SgeI CNNG 7 cut(s) 59, 100, 104, 125, 168, 198, 219
SmlI CTYRAG 1 cut(s) 238
SmoI CTYRAG 1 cut(s) 238
Sse9I AATT 3 cut(s) 18, 103, 245
SspMI CTAG 2 cut(s) 92, 156
TaqII GACCGA 1 cut(s) 89
TasI AATT 3 cut(s) 18, 103, 245
TatI WGTACW 1 cut(s) 132
Tru1I TTAA 4 cut(s) 102, 123, 239, 248
Tru9I TTAA 4 cut(s) 102, 123, 239, 248
Vha464I CTTAAG 1 cut(s) 238
XbaI TCTAGA 1 cut(s) 155
XceI RCATGY 1 cut(s) 189
XspI CTAG 2 cut(s) 92, 156
Zsp2I ATGCAT 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.