Rh2DG566600

Transmembrane protein 97-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
79590062 .. 79590745
684 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG566600.1

Sequence Viewer

Length: 186 bp
ATGGTGACTGCATTAGCGGGACTCATTGGATCAGACAAGGCATCTGGTAAGGTCTTAACATTGTACTACACTTTTTTGGGGTGCGCTGTCCTGACCATACTTCGTGGGTTGATGCCACCATCAACTAGTTCAAACAATGACAAAGCAAGAACAAAAAGGATTGGCGTTCCGAAGAAAATGATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

6.47

Weight (kDa)

10.22

Isoelectric Point (pI)

40.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 17
AclWI GGATC 1 cut(s) 37
AfaI GTAC 1 cut(s) 65
AgsI TTSAA 1 cut(s) 132
AhlI ACTAGT 1 cut(s) 125
AlwI GGATC 1 cut(s) 37
AspLEI GCGC 1 cut(s) 86
AsuHPI GGTGA 1 cut(s) 16
BccI CCATC 1 cut(s) 127
BcuI ACTAGT 1 cut(s) 125
BfaI CTAG 2 cut(s) 126, 184
BmsI GCATC 2 cut(s) 50, 102
BslFI GGGAC 1 cut(s) 33
BsmFI GGGAC 1 cut(s) 33
Bsp143I GATC 2 cut(s) 29, 180
BspACI CCGC 1 cut(s) 17
BspPI GGATC 1 cut(s) 37
BssMI GATC 2 cut(s) 29, 180
BstHHI GCGC 1 cut(s) 86
BstKTI GATC 2 cut(s) 32, 183
BstMBI GATC 2 cut(s) 29, 180
CfoI GCGC 1 cut(s) 86
Csp6I GTAC 1 cut(s) 64
CviQI GTAC 1 cut(s) 64
DpnI GATC 2 cut(s) 31, 182
DpnII GATC 2 cut(s) 29, 180
FaiI YATR 1 cut(s) 98
FaqI GGGAC 1 cut(s) 33
FauI CCCGC 1 cut(s) 10
FspBI CTAG 2 cut(s) 126, 184
GlaI GCGC 1 cut(s) 85
HhaI GCGC 1 cut(s) 86
Hin6I GCGC 1 cut(s) 84
HinP1I GCGC 1 cut(s) 84
HinfI GANTC 1 cut(s) 21
HphI GGTGA 1 cut(s) 16
Hpy188I TCNGA 2 cut(s) 34, 171
Hpy188III TCNNGA 1 cut(s) 91
HpyCH4V TGCA 1 cut(s) 11
HspAI GCGC 1 cut(s) 84
Kzo9I GATC 2 cut(s) 29, 180
LpnPI CCDG 2 cut(s) 30, 104
LweI GCATC 2 cut(s) 50, 102
MaeI CTAG 2 cut(s) 126, 184
MaeIII GTNAC 1 cut(s) 4
MalI GATC 2 cut(s) 31, 182
MboI GATC 2 cut(s) 29, 180
MboII GAAGA 1 cut(s) 184
MlyI GAGTC 1 cut(s) 15
MseI TTAA 1 cut(s) 56
NdeII GATC 2 cut(s) 29, 180
NmuCI GTSAC 1 cut(s) 4
PleI GAGTC 1 cut(s) 15
PpsI GAGTC 1 cut(s) 15
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
SaqAI TTAA 1 cut(s) 56
Sau3AI GATC 2 cut(s) 29, 180
SchI GAGTC 1 cut(s) 15
SetI ASST 1 cut(s) 54
SfaNI GCATC 2 cut(s) 50, 102
SgeI CNNG 7 cut(s) 30, 49, 57, 103, 116, 138, 159
SpeI ACTAGT 1 cut(s) 125
SsiI CCGC 1 cut(s) 17
SspMI CTAG 2 cut(s) 126, 184
TatI WGTACW 1 cut(s) 63
Tru1I TTAA 1 cut(s) 56
Tru9I TTAA 1 cut(s) 56
TseFI GTSAC 1 cut(s) 4
Tsp45I GTSAC 1 cut(s) 4
XspI CTAG 2 cut(s) 126, 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.