Rh5AG482400

Vacuolar protein sorting-associated protein VTA1 homolog

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
82611584 .. 82612526
943 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG482400.1

Sequence Viewer

Length: 186 bp
ATGGAGCGAGGGCTGAAGATTCATCAGAACAAGTGCACCAAGACCACCAATTCCCTCCTGATTTCGCTCATGAAGCAGCTAGAAAAGCTTGAGCAGAAGCAGAAGTATGCGGCATTAGAAAGTAGCAGATATAAGGAAAGCTATGAAAGAAGGAAGGAAACCTCTCGCTGGCCCCCCTGCTGGTGA

Protein Analysis

61

Amino Acids

7.4

Weight (kDa)

9.74

Isoelectric Point (pI)

65.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 110
AcuI CTGAAG 1 cut(s) 35
AfiI CCNNNNNNNGG 2 cut(s) 168, 180
AluBI AGCT 3 cut(s) 79, 88, 141
AluI AGCT 3 cut(s) 79, 88, 141
Alw21I GWGCWC 1 cut(s) 38
Alw44I GTGCAC 1 cut(s) 34
AoxI GGCC 1 cut(s) 170
ApaLI GTGCAC 1 cut(s) 34
ApeKI GCWGC 1 cut(s) 76
AspS9I GGNCC 1 cut(s) 171
BaeGI GKGCMC 1 cut(s) 38
Bbv12I GWGCWC 1 cut(s) 38
BbvI GCAGC 1 cut(s) 88
BfaI CTAG 1 cut(s) 80
BisI GCNGC 2 cut(s) 77, 111
BlsI GCNGC 2 cut(s) 78, 112
BmgT120I GGNCC 1 cut(s) 171
BmiI GGNNCC 1 cut(s) 173
BpuEI CTTGAG 1 cut(s) 110
Bsc4I CCNNNNNNNGG 2 cut(s) 168, 180
BseLI CCNNNNNNNGG 2 cut(s) 168, 180
BseSI GKGCMC 1 cut(s) 38
BseXI GCAGC 1 cut(s) 88
BshFI GGCC 1 cut(s) 172
BsiHKAI GWGCWC 1 cut(s) 38
BslI CCNNNNNNNGG 2 cut(s) 168, 180
BsnI GGCC 1 cut(s) 172
Bsp1286I GDGCHC 1 cut(s) 38
BspACI CCGC 1 cut(s) 110
BspANI GGCC 1 cut(s) 172
BspHI TCATGA 1 cut(s) 69
BspLI GGNNCC 1 cut(s) 173
BstC8I GCNNGC 1 cut(s) 170
BstMWI GCNNNNNNNGC 2 cut(s) 73, 85
BstSLI GKGCMC 1 cut(s) 38
BstV1I GCAGC 1 cut(s) 88
BsuRI GGCC 1 cut(s) 172
Cac8I GCNNGC 1 cut(s) 170
CciI TCATGA 1 cut(s) 69
Cfr13I GGNCC 1 cut(s) 171
CviAII CATG 1 cut(s) 70
CviJI RGCY 5 cut(s) 13, 79, 88, 141, 172
CviKI_1 RGCY 5 cut(s) 13, 79, 88, 141, 172
Eco57I CTGAAG 1 cut(s) 35
FaeI CATG 1 cut(s) 73
FaiI YATR 4 cut(s) 71, 108, 132, 144
FatI CATG 1 cut(s) 69
Fnu4HI GCNGC 2 cut(s) 77, 111
Fsp4HI GCNGC 2 cut(s) 77, 111
FspBI CTAG 1 cut(s) 80
GluI GCNGC 2 cut(s) 77, 111
HaeIII GGCC 1 cut(s) 172
Hin1II CATG 1 cut(s) 73
HindIII AAGCTT 1 cut(s) 86
HinfI GANTC 1 cut(s) 19
Hpy166II GTNNAC 1 cut(s) 36
Hpy188I TCNGA 1 cut(s) 27
Hpy188III TCNNGA 2 cut(s) 58, 70
Hpy8I GTNNAC 1 cut(s) 36
HpyAV CCTTC 2 cut(s) 144, 148
HpyCH4V TGCA 1 cut(s) 36
HpyF10VI GCNNNNNNNGC 2 cut(s) 73, 85
Hsp92II CATG 1 cut(s) 73
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 3 cut(s) 71, 154, 166
Lsp1109I GCAGC 1 cut(s) 88
MaeI CTAG 1 cut(s) 80
MboII GAAGA 1 cut(s) 28
MhlI GDGCHC 1 cut(s) 38
MluCI AATT 1 cut(s) 49
MnlI CCTC 2 cut(s) 65, 172
MwoI GCNNNNNNNGC 2 cut(s) 73, 85
NlaIII CATG 1 cut(s) 73
NlaIV GGNNCC 1 cut(s) 173
PagI TCATGA 1 cut(s) 69
PfeI GAWTC 1 cut(s) 19
PkrI GCNGC 2 cut(s) 78, 112
PspN4I GGNNCC 1 cut(s) 173
PspPI GGNCC 1 cut(s) 171
SatI GCNGC 2 cut(s) 77, 111
Sau96I GGNCC 1 cut(s) 171
SduI GDGCHC 1 cut(s) 38
SetI ASST 4 cut(s) 81, 90, 143, 164
SgeI CNNG 9 cut(s) 20, 43, 52, 70, 82, 92, 101, 177, 181
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
Sse9I AATT 1 cut(s) 49
SsiI CCGC 1 cut(s) 110
SspMI CTAG 1 cut(s) 80
TasI AATT 1 cut(s) 49
TauI GCSGC 1 cut(s) 113
TfiI GAWTC 1 cut(s) 19
TseI GCWGC 1 cut(s) 76
TspDTI ATGAA 3 cut(s) 11, 86, 159
VneI GTGCAC 1 cut(s) 34
XspI CTAG 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.