Rh5BG388200

30S ribosomal protein S20

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
62110763 .. 62121956
11194 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG388200.1

Sequence Viewer

Length: 180 bp
ATGCCCCCATTGATTGCTTCCTTCTCAGTTAATGGCGTTAATGGTTGGTTGCAGAACTTGGAAGCAAGGTACGGTAGTCAAATTGGGTATTTGTCTGCGAGCCCAAGTCAGAGGTCAGTTTGTCGCTCTGTGGTTTGTGAGGCTGCTCCAACCAAGAGGCTTGATTATGTTGAAAAGTGA

Protein Analysis

59

Amino Acids

6.45

Weight (kDa)

8.77

Isoelectric Point (pI)

61.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 71
AgsI TTSAA 1 cut(s) 173
ApeKI GCWGC 1 cut(s) 143
BaeI ACNNNNGTAYC 2 cut(s) 61, 94
BanII GRGCYC 1 cut(s) 104
BbvI GCAGC 1 cut(s) 130
BisI GCNGC 1 cut(s) 144
BlsI GCNGC 1 cut(s) 145
BseMII CTCAG 1 cut(s) 39
BseXI GCAGC 1 cut(s) 130
Bsp1286I GDGCHC 1 cut(s) 104
BspCNI CTCAG 1 cut(s) 38
Bst4CI ACNGT 1 cut(s) 74
BstC8I GCNNGC 1 cut(s) 100
BstDEI CTNAG 1 cut(s) 25
BstV1I GCAGC 1 cut(s) 130
Cac8I GCNNGC 1 cut(s) 100
Csp6I GTAC 1 cut(s) 70
CviJI RGCY 3 cut(s) 102, 143, 160
CviKI_1 RGCY 3 cut(s) 102, 143, 160
CviQI GTAC 1 cut(s) 70
DdeI CTNAG 1 cut(s) 25
Eco24I GRGCYC 1 cut(s) 104
EcoT38I GRGCYC 1 cut(s) 104
FaiI YATR 1 cut(s) 168
Fnu4HI GCNGC 1 cut(s) 144
FriOI GRGCYC 1 cut(s) 104
Fsp4HI GCNGC 1 cut(s) 144
GluI GCNGC 1 cut(s) 144
Hpy188I TCNGA 1 cut(s) 111
HpyAV CCTTC 1 cut(s) 31
HpyCH4III ACNGT 1 cut(s) 74
HpyCH4V TGCA 1 cut(s) 52
HpyF3I CTNAG 1 cut(s) 25
LmnI GCTCC 1 cut(s) 151
Lsp1109I GCAGC 1 cut(s) 130
MhlI GDGCHC 1 cut(s) 104
MluCI AATT 1 cut(s) 81
MmeI TCCRAC 1 cut(s) 173
MnlI CCTC 3 cut(s) 105, 133, 150
MseI TTAA 2 cut(s) 30, 39
PkrI GCNGC 1 cut(s) 145
RsaI GTAC 1 cut(s) 71
RsaNI GTAC 1 cut(s) 70
SaqAI TTAA 2 cut(s) 30, 39
SatI GCNGC 1 cut(s) 144
SduI GDGCHC 1 cut(s) 104
SetI ASST 2 cut(s) 71, 116
SgeI CNNG 6 cut(s) 70, 78, 111, 117, 166, 173
Sse9I AATT 1 cut(s) 81
TaaI ACNGT 1 cut(s) 74
TasI AATT 1 cut(s) 81
Tru1I TTAA 2 cut(s) 30, 39
Tru9I TTAA 2 cut(s) 30, 39
TseI GCWGC 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.