Rh5BG111200

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
10408784 .. 10409818
1035 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG111200.1

Sequence Viewer

Length: 300 bp
ATGCAAGAAACTGGATTTAATTTGCAGGGATTTGGAAAGAAAATCGAGGACACGCAGGTCAAGTTTGATGAATTGGTGGAGAAGGTTGTTAATGAACATGAACAACTGAGAATTAAGAACAACAACATTAAGGGAGGAGAGGAGGATGAGAAGGAGGTCAAGGATTTTCCAAGCATCTTGCTTGATATGTTGGAATATGAGAGTAGTGAGAGCGTGGAGGTTGGATTTTCAAGAGTTCACATTAAGGCTGTAATTATGGTAATAATTAACATAATGATACTAGCTAGGGTTCTTTTATAG

Protein Analysis

99

Amino Acids

11.38

Weight (kDa)

4.8

Isoelectric Point (pI)

48.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 56
Acc36I ACCTGC 1 cut(s) 46
AgsI TTSAA 1 cut(s) 231
AluBI AGCT 1 cut(s) 284
AluI AGCT 1 cut(s) 284
BfaI CTAG 2 cut(s) 281, 285
BfuAI ACCTGC 1 cut(s) 46
BmsI GCATC 1 cut(s) 183
Bse1I ACTGG 1 cut(s) 16
BseGI GGATG 1 cut(s) 151
BseMII CTCAG 1 cut(s) 98
BseNI ACTGG 1 cut(s) 16
BseRI GAGGAG 2 cut(s) 150, 155
BspCNI CTCAG 1 cut(s) 99
BspMI ACCTGC 1 cut(s) 46
BsrI ACTGG 1 cut(s) 16
BstDEI CTNAG 1 cut(s) 107
BstF5I GGATG 1 cut(s) 151
BtsCI GGATG 1 cut(s) 151
BveI ACCTGC 1 cut(s) 46
CviAII CATG 1 cut(s) 98
CviJI RGCY 2 cut(s) 248, 284
CviKI_1 RGCY 2 cut(s) 248, 284
DdeI CTNAG 1 cut(s) 107
DrdI GACNNNNNNGTC 1 cut(s) 56
DseDI GACNNNNNNGTC 1 cut(s) 56
FaeI CATG 1 cut(s) 101
FaiI YATR 6 cut(s) 99, 188, 198, 257, 272, 298
FatI CATG 1 cut(s) 97
FokI GGATG 1 cut(s) 158
FspBI CTAG 2 cut(s) 281, 285
Hin1II CATG 1 cut(s) 101
Hpy166II GTNNAC 1 cut(s) 238
Hpy188III TCNNGA 1 cut(s) 231
Hpy8I GTNNAC 1 cut(s) 238
HpyAV CCTTC 2 cut(s) 76, 145
HpyCH4V TGCA 2 cut(s) 4, 25
HpyF3I CTNAG 1 cut(s) 107
Hsp92II CATG 1 cut(s) 101
LpnPI CCDG 2 cut(s) 11, 41
LweI GCATC 1 cut(s) 183
MaeI CTAG 2 cut(s) 281, 285
MluCI AATT 5 cut(s) 19, 71, 111, 252, 264
MmeI TCCRAC 2 cut(s) 171, 202
MnlI CCTC 6 cut(s) 40, 128, 133, 136, 148, 211
MseI TTAA 6 cut(s) 18, 90, 114, 129, 243, 267
NlaIII CATG 1 cut(s) 101
SaqAI TTAA 6 cut(s) 18, 90, 114, 129, 243, 267
SetI ASST 5 cut(s) 60, 87, 159, 222, 286
SfaNI GCATC 1 cut(s) 183
Sse9I AATT 5 cut(s) 19, 71, 111, 252, 264
SspMI CTAG 2 cut(s) 281, 285
TaqI TCGA 1 cut(s) 45
TasI AATT 5 cut(s) 19, 71, 111, 252, 264
Tru1I TTAA 6 cut(s) 18, 90, 114, 129, 243, 267
Tru9I TTAA 6 cut(s) 18, 90, 114, 129, 243, 267
TspDTI ATGAA 3 cut(s) 84, 108, 114
XspI CTAG 2 cut(s) 281, 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.