Rh5CG030000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
1914039 .. 1914218
180 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG030000.1

Sequence Viewer

Length: 180 bp
ATGGCTGATGAAGATGAAGATAAAGATAAATATGACTACGTTTATTGTCGGCATTGTTATAAGAGTGGTGAACATAAAACTGCAGTGTGCCCCAACAAATCAAACATCCGAGTAATGATTTGTGGCATTTGCAAGATCCCGTGTCTGTGTAAAAATCAGGAAGAGCATGGTAATATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.86

Weight (kDa)

6.25

Isoelectric Point (pI)

37.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 60
AclWI GGATC 1 cut(s) 130
AlwI GGATC 1 cut(s) 130
AsuHPI GGTGA 1 cut(s) 80
BaeGI GKGCMC 1 cut(s) 92
BfmI CTRYAG 1 cut(s) 81
BseGI GGATG 1 cut(s) 105
BseSI GKGCMC 1 cut(s) 92
Bsp1286I GDGCHC 1 cut(s) 92
Bsp143I GATC 1 cut(s) 135
BspMAI CTGCAG 1 cut(s) 85
BspPI GGATC 1 cut(s) 130
BspQI GCTCTTC 1 cut(s) 156
BssMI GATC 1 cut(s) 135
Bst6I CTCTTC 1 cut(s) 156
BstF5I GGATG 1 cut(s) 105
BstKTI GATC 1 cut(s) 138
BstMBI GATC 1 cut(s) 135
BstSFI CTRYAG 1 cut(s) 81
BstSLI GKGCMC 1 cut(s) 92
BstX2I RGATCY 1 cut(s) 135
BstYI RGATCY 1 cut(s) 135
BtsCI GGATG 1 cut(s) 105
BtsI GCAGTG 1 cut(s) 90
BtsIMutI CAGTG 1 cut(s) 90
CviAII CATG 1 cut(s) 167
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
DpnI GATC 1 cut(s) 137
DpnII GATC 1 cut(s) 135
Eam1104I CTCTTC 1 cut(s) 156
EarI CTCTTC 1 cut(s) 156
FaeI CATG 1 cut(s) 170
FaiI YATR 5 cut(s) 33, 60, 75, 168, 176
FatI CATG 1 cut(s) 166
FokI GGATG 1 cut(s) 92
Hin1II CATG 1 cut(s) 170
HphI GGTGA 1 cut(s) 80
Hpy166II GTNNAC 1 cut(s) 71
Hpy188I TCNGA 1 cut(s) 110
Hpy188III TCNNGA 1 cut(s) 158
Hpy8I GTNNAC 1 cut(s) 71
HpyCH4IV ACGT 1 cut(s) 39
HpyCH4V TGCA 2 cut(s) 83, 132
HpySE526I ACGT 1 cut(s) 39
Hsp92II CATG 1 cut(s) 170
Kzo9I GATC 1 cut(s) 135
LguI GCTCTTC 1 cut(s) 156
LpnPI CCDG 1 cut(s) 143
MaeII ACGT 1 cut(s) 39
MalI GATC 1 cut(s) 137
MboI GATC 1 cut(s) 135
MboII GAAGA 3 cut(s) 23, 29, 173
MflI RGATCY 1 cut(s) 135
MhlI GDGCHC 1 cut(s) 92
NdeII GATC 1 cut(s) 135
NlaIII CATG 1 cut(s) 170
PciSI GCTCTTC 1 cut(s) 156
PsiI TTATAA 1 cut(s) 60
PstI CTGCAG 1 cut(s) 85
PsuI RGATCY 1 cut(s) 135
SapI GCTCTTC 1 cut(s) 156
Sau3AI GATC 1 cut(s) 135
SduI GDGCHC 1 cut(s) 92
SetI ASST 1 cut(s) 42
SfcI CTRYAG 1 cut(s) 81
SgeI CNNG 5 cut(s) 122, 145, 151, 153, 170
TaiI ACGT 1 cut(s) 42
TscAI CASTG 1 cut(s) 90
TspDTI ATGAA 2 cut(s) 24, 30
TspRI CASTG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.