Rh6AG066000

Belongs to the adenylate kinase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
9663036 .. 9664048
1013 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG066000.1

Sequence Viewer

Length: 201 bp
ATGGATTCATTCTTGATGGGATTCCTCAAACTAGAATTCAAGCTATCGAGCAAGTTGTTGGAGGATTACTACAGAAAACAGAACAAACTCATTGATTTTCATGTGAAAGGTGCCCCCGGAGAAACCTGGAAGGGGCTGCTGGCTGCATTGCATCTCCAGCATATAAATGCTGTCAGTTCTTTCCAGAAGCTAACTGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.57

Weight (kDa)

9.4

Isoelectric Point (pI)

23.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 110
AcsI RAATTY 1 cut(s) 35
AfiI CCNNNNNNNGG 1 cut(s) 132
AgsI TTSAA 1 cut(s) 40
AjnI CCWGG 1 cut(s) 125
AluBI AGCT 2 cut(s) 43, 190
AluI AGCT 2 cut(s) 43, 190
ApeKI GCWGC 2 cut(s) 136, 143
ApoI RAATTY 1 cut(s) 35
AsuC2I CCSGG 1 cut(s) 117
BaeGI GKGCMC 1 cut(s) 115
BanI GGYRCC 1 cut(s) 110
BbvI GCAGC 2 cut(s) 123, 130
BccI CCATC 1 cut(s) 10
BciT130I CCWGG 1 cut(s) 127
BcnI CCSGG 1 cut(s) 117
BfaI CTAG 1 cut(s) 32
BfmI CTRYAG 1 cut(s) 70
BisI GCNGC 2 cut(s) 137, 144
BlsI GCNGC 2 cut(s) 138, 145
Bme1390I CCNGG 2 cut(s) 117, 127
BmiI GGNNCC 1 cut(s) 112
BmrFI CCNGG 2 cut(s) 117, 127
BmsI GCATC 1 cut(s) 160
BpmI CTGGAG 1 cut(s) 140
BpuMI CCSGG 1 cut(s) 117
BsaJI CCNNGG 1 cut(s) 115
Bsc4I CCNNNNNNNGG 1 cut(s) 132
Bse3DI GCAATG 1 cut(s) 146
BseBI CCWGG 1 cut(s) 127
BseDI CCNNGG 1 cut(s) 115
BseLI CCNNNNNNNGG 1 cut(s) 132
BseMI GCAATG 1 cut(s) 146
BseSI GKGCMC 1 cut(s) 115
BseXI GCAGC 2 cut(s) 123, 130
BshNI GGYRCC 1 cut(s) 110
BsiSI CCGG 1 cut(s) 117
BslI CCNNNNNNNGG 1 cut(s) 132
Bsp1286I GDGCHC 1 cut(s) 115
BspLI GGNNCC 1 cut(s) 112
BspT107I GGYRCC 1 cut(s) 110
BsrDI GCAATG 1 cut(s) 146
BssECI CCNNGG 1 cut(s) 115
Bst2UI CCWGG 1 cut(s) 127
BstC8I GCNNGC 1 cut(s) 141
BstMWI GCNNNNNNNGC 1 cut(s) 157
BstNI CCWGG 1 cut(s) 127
BstSCI CCNGG 2 cut(s) 115, 125
BstSFI CTRYAG 1 cut(s) 70
BstSLI GKGCMC 1 cut(s) 115
BstV1I GCAGC 2 cut(s) 123, 130
Cac8I GCNNGC 1 cut(s) 141
CviAII CATG 2 cut(s) 101, 198
CviJI RGCY 4 cut(s) 43, 136, 143, 190
CviKI_1 RGCY 4 cut(s) 43, 136, 143, 190
EcoRI GAATTC 1 cut(s) 35
EcoRII CCWGG 1 cut(s) 125
FaeI CATG 2 cut(s) 104, 201
FaiI YATR 4 cut(s) 102, 162, 164, 199
FatI CATG 2 cut(s) 100, 197
Fnu4HI GCNGC 2 cut(s) 137, 144
Fsp4HI GCNGC 2 cut(s) 137, 144
FspBI CTAG 1 cut(s) 32
GluI GCNGC 2 cut(s) 137, 144
GsuI CTGGAG 1 cut(s) 140
HapII CCGG 1 cut(s) 117
Hin1II CATG 2 cut(s) 104, 201
HinfI GANTC 2 cut(s) 5, 21
HpaII CCGG 1 cut(s) 117
Hpy188III TCNNGA 2 cut(s) 13, 184
HpyAV CCTTC 1 cut(s) 124
HpyCH4V TGCA 3 cut(s) 146, 151, 197
HpyF10VI GCNNNNNNNGC 1 cut(s) 157
Hsp92II CATG 2 cut(s) 104, 201
LpnPI CCDG 6 cut(s) 112, 125, 130, 139, 170, 197
Lsp1109I GCAGC 2 cut(s) 123, 130
LweI GCATC 1 cut(s) 160
MaeI CTAG 1 cut(s) 32
MhlI GDGCHC 1 cut(s) 115
MluCI AATT 1 cut(s) 35
MmeI TCCRAC 1 cut(s) 39
MnlI CCTC 2 cut(s) 35, 55
MslI CAYNNNNRTG 1 cut(s) 165
MspI CCGG 1 cut(s) 117
MspR9I CCNGG 2 cut(s) 117, 127
MvaI CCWGG 1 cut(s) 127
MwoI GCNNNNNNNGC 1 cut(s) 157
NciI CCSGG 1 cut(s) 117
NlaIII CATG 2 cut(s) 104, 201
NlaIV GGNNCC 1 cut(s) 112
PfeI GAWTC 2 cut(s) 5, 21
PkrI GCNGC 2 cut(s) 138, 145
Psp6I CCWGG 1 cut(s) 125
PspGI CCWGG 1 cut(s) 125
PspN4I GGNNCC 1 cut(s) 112
RseI CAYNNNNRTG 1 cut(s) 165
SatI GCNGC 2 cut(s) 137, 144
ScrFI CCNGG 2 cut(s) 117, 127
SduI GDGCHC 1 cut(s) 115
SetI ASST 4 cut(s) 45, 112, 128, 192
SfaNI GCATC 1 cut(s) 160
SfcI CTRYAG 1 cut(s) 70
SmiMI CAYNNNNRTG 1 cut(s) 165
Sse9I AATT 1 cut(s) 35
SspMI CTAG 1 cut(s) 32
StyD4I CCNGG 2 cut(s) 115, 125
TaqI TCGA 1 cut(s) 47
TasI AATT 1 cut(s) 35
TfiI GAWTC 2 cut(s) 5, 21
TseI GCWGC 2 cut(s) 136, 143
TspDTI ATGAA 1 cut(s) 89
XapI RAATTY 1 cut(s) 35
XspI CTAG 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.