Rh7AG438800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0003282
Physical Location & Seq
Reverse (-)
59162942 .. 59163190
249 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG438800.1

Sequence Viewer

Length: 249 bp
ATGAGGGCAGGGGTCATCTCGACTTGCAGTGGTGGTTGGTTCGGCAGCAAAGACGACTGGGCTGGCCTTCAGCCGTCGTCTAGGGCTTTACCAATTGATGGATGTGATGGAGATCCAGGGGTTGATATAGGGCTGGTTTGGCCTGAGATTGGAAGCTATCGTGTTGGGATGATTACTCCCTCGTCCAGCACAGCCAGTTTTGGTAGAAGTAGGATATTGGATTCGGTGATGACAGCGAAGCAACGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

8.62

Weight (kDa)

6.04

Isoelectric Point (pI)

49.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 98
AclWI GGATC 1 cut(s) 107
AcuI CTGAAG 1 cut(s) 53
AfiI CCNNNNNNNGG 2 cut(s) 98, 149
AjnI CCWGG 1 cut(s) 115
AluBI AGCT 1 cut(s) 156
AluI AGCT 1 cut(s) 156
AlwI GGATC 1 cut(s) 107
AoxI GGCC 2 cut(s) 64, 140
ApeKI GCWGC 1 cut(s) 45
AsuHPI GGTGA 1 cut(s) 238
BbvI GCAGC 1 cut(s) 57
BccI CCATC 2 cut(s) 92, 101
BceAI ACGGC 1 cut(s) 58
BciT130I CCWGG 1 cut(s) 117
BfaI CTAG 1 cut(s) 81
BisI GCNGC 1 cut(s) 46
BlsI GCNGC 1 cut(s) 47
Bme1390I CCNGG 1 cut(s) 117
BmrFI CCNGG 1 cut(s) 117
BmrI ACTGGG 1 cut(s) 67
BmuI ACTGGG 1 cut(s) 67
BsaBI GATNNNNATC 1 cut(s) 111
BsaJI CCNNGG 1 cut(s) 116
Bsc4I CCNNNNNNNGG 2 cut(s) 98, 149
Bse1I ACTGG 2 cut(s) 62, 195
Bse8I GATNNNNATC 1 cut(s) 111
BseBI CCWGG 1 cut(s) 117
BseDI CCNNGG 1 cut(s) 116
BseGI GGATG 2 cut(s) 107, 174
BseJI GATNNNNATC 1 cut(s) 111
BseLI CCNNNNNNNGG 2 cut(s) 98, 149
BseMII CTCAG 1 cut(s) 135
BseNI ACTGG 2 cut(s) 62, 195
BseXI GCAGC 1 cut(s) 57
BshFI GGCC 2 cut(s) 66, 142
BslI CCNNNNNNNGG 2 cut(s) 98, 149
BsnI GGCC 2 cut(s) 66, 142
Bsp143I GATC 1 cut(s) 112
BspANI GGCC 2 cut(s) 66, 142
BspCNI CTCAG 1 cut(s) 136
BspPI GGATC 1 cut(s) 107
BsrI ACTGG 2 cut(s) 62, 195
BssECI CCNNGG 1 cut(s) 116
BssMI GATC 1 cut(s) 112
Bst2UI CCWGG 1 cut(s) 117
BstC8I GCNNGC 1 cut(s) 64
BstDEI CTNAG 1 cut(s) 144
BstF5I GGATG 2 cut(s) 107, 174
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BstMWI GCNNNNNNNGC 1 cut(s) 139
BstNI CCWGG 1 cut(s) 117
BstSCI CCNGG 1 cut(s) 115
BstV1I GCAGC 1 cut(s) 57
BstX2I RGATCY 1 cut(s) 112
BstYI RGATCY 1 cut(s) 112
BsuRI GGCC 2 cut(s) 66, 142
BtsCI GGATG 2 cut(s) 107, 174
BtsI GCAGTG 1 cut(s) 34
BtsIMutI CAGTG 1 cut(s) 34
Cac8I GCNNGC 1 cut(s) 64
CviJI RGCY 8 cut(s) 62, 66, 73, 86, 133, 142, 156, 194
CviKI_1 RGCY 8 cut(s) 62, 66, 73, 86, 133, 142, 156, 194
DdeI CTNAG 1 cut(s) 144
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
Eco57I CTGAAG 1 cut(s) 53
EcoRII CCWGG 1 cut(s) 115
FaiI YATR 1 cut(s) 128
Fnu4HI GCNGC 1 cut(s) 46
FokI GGATG 2 cut(s) 114, 181
Fsp4HI GCNGC 1 cut(s) 46
FspBI CTAG 1 cut(s) 81
GluI GCNGC 1 cut(s) 46
HaeIII GGCC 2 cut(s) 66, 142
HinfI GANTC 1 cut(s) 221
HphI GGTGA 1 cut(s) 238
Hpy188III TCNNGA 1 cut(s) 19
Hpy99I CGWCG 1 cut(s) 79
HpyAV CCTTC 1 cut(s) 77
HpyCH4V TGCA 1 cut(s) 27
HpyF10VI GCNNNNNNNGC 1 cut(s) 139
HpyF3I CTNAG 1 cut(s) 144
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 8 cut(s) 43, 48, 102, 119, 129, 156, 199, 208
Lsp1109I GCAGC 1 cut(s) 57
MaeI CTAG 1 cut(s) 81
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MfeI CAATTG 1 cut(s) 93
MflI RGATCY 1 cut(s) 112
MluCI AATT 1 cut(s) 93
MnlI CCTC 1 cut(s) 190
MspR9I CCNGG 1 cut(s) 117
MunI CAATTG 1 cut(s) 93
MvaI CCWGG 1 cut(s) 117
MwoI GCNNNNNNNGC 1 cut(s) 139
NdeII GATC 1 cut(s) 112
PfeI GAWTC 1 cut(s) 221
PflMI CCANNNNNTGG 1 cut(s) 98
PkrI GCNGC 1 cut(s) 47
Psp6I CCWGG 1 cut(s) 115
PspGI CCWGG 1 cut(s) 115
PsuI RGATCY 1 cut(s) 112
SatI GCNGC 1 cut(s) 46
Sau3AI GATC 1 cut(s) 112
ScrFI CCNGG 1 cut(s) 117
SetI ASST 1 cut(s) 158
Sse9I AATT 1 cut(s) 93
SspMI CTAG 1 cut(s) 81
StyD4I CCNGG 1 cut(s) 115
TaqI TCGA 1 cut(s) 20
TasI AATT 1 cut(s) 93
TfiI GAWTC 1 cut(s) 221
TscAI CASTG 1 cut(s) 34
TseI GCWGC 1 cut(s) 45
TspRI CASTG 1 cut(s) 34
Van91I CCANNNNNTGG 1 cut(s) 98
XspI CTAG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.