Rh7CG173100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0003285
Physical Location & Seq
Reverse (-)
14654530 .. 14654763
234 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG173100.1

Sequence Viewer

Length: 234 bp
ATGGCTACTTCCTCCTACCCGGAAACCCTAGATCTGGTCCTCACACATCGTATCTCATGCTCATCTGCCTCGAATCCACCAACTACTTCATCTGGTCCGCATCTCATGACCACCATCTTCACCGCCCAAGGCCTCCACGGCTACGTCGATGGCACCATCAAAACCCCTGACAAATTCGCCCTCAACGCCAGAGGCGAACCCACCGCACAGCTCACCTCAGACTTCAAGCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.2

Weight (kDa)

6.23

Isoelectric Point (pI)

16.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 152
AciI CCGC 3 cut(s) 98, 123, 204
AcsI RAATTY 1 cut(s) 173
AfiI CCNNNNNNNGG 1 cut(s) 34
AgsI TTSAA 1 cut(s) 226
AluBI AGCT 2 cut(s) 211, 229
AluI AGCT 2 cut(s) 211, 229
AoxI GGCC 1 cut(s) 130
ApoI RAATTY 1 cut(s) 173
AspS9I GGNCC 2 cut(s) 37, 95
AsuC2I CCSGG 1 cut(s) 20
AsuHPI GGTGA 2 cut(s) 112, 205
AvaII GGWCC 2 cut(s) 37, 95
BanI GGYRCC 1 cut(s) 152
BccI CCATC 3 cut(s) 122, 143, 164
BceAI ACGGC 1 cut(s) 154
BcnI CCSGG 1 cut(s) 20
BfaI CTAG 1 cut(s) 29
BglI GCCNNNNNGGC 1 cut(s) 138
BglII AGATCT 1 cut(s) 31
Bme1390I CCNGG 1 cut(s) 20
Bme18I GGWCC 2 cut(s) 37, 95
BmgT120I GGNCC 2 cut(s) 37, 95
BmiI GGNNCC 1 cut(s) 154
BmrFI CCNGG 1 cut(s) 20
BmsI GCATC 1 cut(s) 109
BpuMI CCSGG 1 cut(s) 20
BsaJI CCNNGG 2 cut(s) 127, 136
Bsc4I CCNNNNNNNGG 1 cut(s) 34
BseDI CCNNGG 2 cut(s) 127, 136
BseLI CCNNNNNNNGG 1 cut(s) 34
BseMII CTCAG 1 cut(s) 231
BshFI GGCC 1 cut(s) 132
BshNI GGYRCC 1 cut(s) 152
BsiSI CCGG 1 cut(s) 20
BslI CCNNNNNNNGG 1 cut(s) 34
BsnI GGCC 1 cut(s) 132
Bsp143I GATC 1 cut(s) 31
BspACI CCGC 3 cut(s) 98, 123, 204
BspANI GGCC 1 cut(s) 132
BspCNI CTCAG 1 cut(s) 230
BspHI TCATGA 1 cut(s) 105
BspLI GGNNCC 1 cut(s) 154
BspT107I GGYRCC 1 cut(s) 152
BssECI CCNNGG 2 cut(s) 127, 136
BssMI GATC 1 cut(s) 31
BssT1I CCWWGG 1 cut(s) 127
BstDEI CTNAG 1 cut(s) 217
BstDSI CCRYGG 1 cut(s) 136
BstKTI GATC 1 cut(s) 34
BstMBI GATC 1 cut(s) 31
BstMWI GCNNNNNNNGC 2 cut(s) 138, 185
BstSCI CCNGG 1 cut(s) 18
BstX2I RGATCY 1 cut(s) 31
BstYI RGATCY 1 cut(s) 31
BsuRI GGCC 1 cut(s) 132
BtgI CCRYGG 1 cut(s) 136
CciI TCATGA 1 cut(s) 105
Cfr13I GGNCC 2 cut(s) 37, 95
CviAII CATG 2 cut(s) 57, 106
CviJI RGCY 5 cut(s) 5, 132, 141, 211, 229
CviKI_1 RGCY 5 cut(s) 5, 132, 141, 211, 229
DdeI CTNAG 1 cut(s) 217
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
Eco130I CCWWGG 1 cut(s) 127
Eco147I AGGCCT 1 cut(s) 132
Eco47I GGWCC 2 cut(s) 37, 95
EcoT14I CCWWGG 1 cut(s) 127
ErhI CCWWGG 1 cut(s) 127
FaeI CATG 2 cut(s) 60, 109
FaiI YATR 2 cut(s) 58, 107
FatI CATG 2 cut(s) 56, 105
FspBI CTAG 1 cut(s) 29
HaeIII GGCC 1 cut(s) 132
HapII CCGG 1 cut(s) 20
Hin1II CATG 2 cut(s) 60, 109
HindIII AAGCTT 1 cut(s) 227
HinfI GANTC 1 cut(s) 73
HpaII CCGG 1 cut(s) 20
HphI GGTGA 2 cut(s) 112, 205
Hpy188I TCNGA 1 cut(s) 220
Hpy188III TCNNGA 1 cut(s) 106
Hpy99I CGWCG 1 cut(s) 149
HpyCH4IV ACGT 1 cut(s) 144
HpyF10VI GCNNNNNNNGC 2 cut(s) 138, 185
HpyF3I CTNAG 1 cut(s) 217
HpySE526I ACGT 1 cut(s) 144
Hsp92II CATG 2 cut(s) 60, 109
Kzo9I GATC 1 cut(s) 31
LpnPI CCDG 5 cut(s) 20, 33, 78, 180, 202
LweI GCATC 1 cut(s) 109
MaeI CTAG 1 cut(s) 29
MaeII ACGT 1 cut(s) 144
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MboII GAAGA 1 cut(s) 109
MflI RGATCY 1 cut(s) 31
MluCI AATT 1 cut(s) 173
MnlI CCTC 7 cut(s) 22, 50, 79, 143, 185, 191, 226
MspI CCGG 1 cut(s) 20
MspR9I CCNGG 1 cut(s) 20
MwoI GCNNNNNNNGC 2 cut(s) 138, 185
NciI CCSGG 1 cut(s) 20
NdeII GATC 1 cut(s) 31
NlaIII CATG 2 cut(s) 60, 109
NlaIV GGNNCC 1 cut(s) 154
PagI TCATGA 1 cut(s) 105
PceI AGGCCT 1 cut(s) 132
PcsI WCGNNNNNNNCGW 2 cut(s) 144, 192
PfeI GAWTC 1 cut(s) 73
PspN4I GGNNCC 1 cut(s) 154
PspPI GGNCC 2 cut(s) 37, 95
PsuI RGATCY 1 cut(s) 31
Sau3AI GATC 1 cut(s) 31
Sau96I GGNCC 2 cut(s) 37, 95
ScrFI CCNGG 1 cut(s) 20
SetI ASST 4 cut(s) 147, 213, 218, 231
SfaNI GCATC 1 cut(s) 109
SinI GGWCC 2 cut(s) 37, 95
Sse9I AATT 1 cut(s) 173
SseBI AGGCCT 1 cut(s) 132
SsiI CCGC 3 cut(s) 98, 123, 204
SspMI CTAG 1 cut(s) 29
StuI AGGCCT 1 cut(s) 132
StyD4I CCNGG 1 cut(s) 18
StyI CCWWGG 1 cut(s) 127
TaiI ACGT 1 cut(s) 147
TaqI TCGA 2 cut(s) 71, 147
TasI AATT 1 cut(s) 173
TfiI GAWTC 1 cut(s) 73
TspDTI ATGAA 1 cut(s) 78
VpaK11BI GGWCC 2 cut(s) 37, 95
XapI RAATTY 1 cut(s) 173
XspI CTAG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.