FvH4_2g30460

Encoded by

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
Physical Location & Seq
Forward (+)
23599548 .. 23600979
1432 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g30460.t1

Sequence Viewer

Length: 519 bp
ATGGATATGATCCTGGCTACGGTTACAGTTACGAGAGATAATTTATGTAATTGTGGCTTTGATGGTGGGAATGGACGCCTTGATAAGCTAAACATGGGCGCATTGTTTTTGAAACTGGTGTTTTTGTTCATGTCCGTGACCATATTAGAAGCCAAAACACATGTTCGCATCATTAACGATTTCCCGGACCACTCGGTACTATCCGTCCACTGTCGATCTAAGAACAATGATCTTGGCTGGCATTACCTCTCCTACAATAGCTCCTATGAATTTCGTTTTAGGCCCAACTTGTGGGGGACGACTCTATTTGCCTGTGAGATGAAGTGGCCTCCTTCAAATAGTCACGGTGTCGTAATCTATCGTTTCAAAAGAGACTATGACTGTCATTTTACAGGTGGCACATGTACGTGGTACATAAAACCAACTGGTCCGTGTATGTTTATGAAAGATTACCCCATGATGTGTTTGGGTTGGGATCAGCCGCCCAATTACCGTATGGAAATGCAAAATGGAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

173

Amino Acids

19.98

Weight (kDa)

8.11

Isoelectric Point (pI)

29.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 54 - 155 4.6e-27 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 291
AciI CCGC 1 cut(s) 482
AclWI GGATC 2 cut(s) 4, 483
AcsI RAATTY 1 cut(s) 269
AcyI GRCGYC 1 cut(s) 76
AfaI GTAC 3 cut(s) 198, 406, 413
AfiI CCNNNNNNNGG 2 cut(s) 19, 291
AflIII ACRYGT 2 cut(s) 160, 401
AgsI TTSAA 3 cut(s) 112, 336, 367
AjnI CCWGG 1 cut(s) 12
AluBI AGCT 2 cut(s) 88, 261
AluI AGCT 2 cut(s) 88, 261
Alw26I GTCTC 1 cut(s) 366
AlwI GGATC 2 cut(s) 4, 483
AoxI GGCC 2 cut(s) 281, 326
ApoI RAATTY 1 cut(s) 269
AspLEI GCGC 1 cut(s) 101
AspS9I GGNCC 3 cut(s) 187, 282, 428
AsuC2I CCSGG 1 cut(s) 185
AvaII GGWCC 2 cut(s) 187, 428
BccI CCATC 1 cut(s) 56
BciT130I CCWGG 1 cut(s) 14
BcnI CCSGG 1 cut(s) 185
BcoDI GTCTC 1 cut(s) 366
BisI GCNGC 1 cut(s) 482
BlsI GCNGC 1 cut(s) 483
Bme1390I CCNGG 2 cut(s) 14, 185
Bme18I GGWCC 2 cut(s) 187, 428
BmgT120I GGNCC 3 cut(s) 187, 282, 428
BmrFI CCNGG 2 cut(s) 14, 185
BmsI GCATC 1 cut(s) 177
BpuMI CCSGG 1 cut(s) 185
BsaAI YACGTR 1 cut(s) 408
BsaHI GRCGYC 1 cut(s) 76
BsaXI ACNNNNNCTCC 2 cut(s) 245, 275
Bsc4I CCNNNNNNNGG 2 cut(s) 19, 291
Bse1I ACTGG 2 cut(s) 120, 430
BseBI CCWGG 1 cut(s) 14
BseLI CCNNNNNNNGG 2 cut(s) 19, 291
BseNI ACTGG 2 cut(s) 120, 430
BshFI GGCC 2 cut(s) 283, 328
BsiSI CCGG 1 cut(s) 185
BslFI GGGAC 1 cut(s) 310
BslI CCNNNNNNNGG 2 cut(s) 19, 291
BsmAI GTCTC 1 cut(s) 366
BsmFI GGGAC 1 cut(s) 310
BsnI GGCC 2 cut(s) 283, 328
Bsp143I GATC 4 cut(s) 9, 215, 229, 475
BspACI CCGC 1 cut(s) 482
BspANI GGCC 2 cut(s) 283, 328
BspPI GGATC 2 cut(s) 4, 483
BsrI ACTGG 2 cut(s) 120, 430
BssMI GATC 4 cut(s) 9, 215, 229, 475
BssNI GRCGYC 1 cut(s) 76
Bst2UI CCWGG 1 cut(s) 14
Bst4CI ACNGT 6 cut(s) 22, 28, 212, 347, 383, 494
BstACI GRCGYC 1 cut(s) 76
BstBAI YACGTR 1 cut(s) 408
BstC8I GCNNGC 1 cut(s) 239
BstDEI CTNAG 1 cut(s) 219
BstHHI GCGC 1 cut(s) 101
BstKTI GATC 4 cut(s) 12, 218, 232, 478
BstMAI GTCTC 1 cut(s) 366
BstMBI GATC 4 cut(s) 9, 215, 229, 475
BstNI CCWGG 1 cut(s) 14
BstNSI RCATGY 2 cut(s) 164, 405
BstSCI CCNGG 2 cut(s) 12, 183
BsuRI GGCC 2 cut(s) 283, 328
BtsIMutI CAGTG 1 cut(s) 208
Cac8I GCNNGC 1 cut(s) 239
CfoI GCGC 1 cut(s) 101
Cfr13I GGNCC 3 cut(s) 187, 282, 428
CseI GACGC 1 cut(s) 84
Csp6I GTAC 3 cut(s) 197, 405, 412
CviAII CATG 5 cut(s) 94, 130, 161, 402, 457
CviJI RGCY 9 cut(s) 17, 57, 88, 152, 237, 261, 283, 328, 481
CviKI_1 RGCY 9 cut(s) 17, 57, 88, 152, 237, 261, 283, 328, 481
CviQI GTAC 3 cut(s) 197, 405, 412
DdeI CTNAG 1 cut(s) 219
DpnI GATC 4 cut(s) 11, 217, 231, 477
DpnII GATC 4 cut(s) 9, 215, 229, 475
Eco47I GGWCC 2 cut(s) 187, 428
EcoRII CCWGG 1 cut(s) 12
FaeI CATG 5 cut(s) 97, 133, 164, 405, 460
FaqI GGGAC 1 cut(s) 310
FatI CATG 5 cut(s) 93, 129, 160, 401, 456
Fnu4HI GCNGC 1 cut(s) 482
Fsp4HI GCNGC 1 cut(s) 482
GlaI GCGC 1 cut(s) 100
GluI GCNGC 1 cut(s) 482
HaeIII GGCC 2 cut(s) 283, 328
HapII CCGG 1 cut(s) 185
HgaI GACGC 1 cut(s) 84
HhaI GCGC 1 cut(s) 101
Hin1I GRCGYC 1 cut(s) 76
Hin1II CATG 5 cut(s) 97, 133, 164, 405, 460
Hin6I GCGC 1 cut(s) 99
HinP1I GCGC 1 cut(s) 99
HinfI GANTC 1 cut(s) 301
HpaII CCGG 1 cut(s) 185
Hpy166II GTNNAC 1 cut(s) 208
Hpy8I GTNNAC 1 cut(s) 208
HpyAV CCTTC 1 cut(s) 342
HpyCH4III ACNGT 6 cut(s) 22, 28, 212, 347, 383, 494
HpyCH4IV ACGT 1 cut(s) 407
HpyCH4V TGCA 1 cut(s) 505
HpyF3I CTNAG 1 cut(s) 219
HpySE526I ACGT 1 cut(s) 407
Hsp92I GRCGYC 1 cut(s) 76
Hsp92II CATG 5 cut(s) 97, 133, 164, 405, 460
HspAI GCGC 1 cut(s) 99
Kzo9I GATC 4 cut(s) 9, 215, 229, 475
LmnI GCTCC 1 cut(s) 266
LpnPI CCDG 7 cut(s) 26, 101, 198, 223, 325, 378, 411
LweI GCATC 1 cut(s) 177
MaeII ACGT 1 cut(s) 407
MaeIII GTNAC 4 cut(s) 22, 28, 136, 341
MalI GATC 4 cut(s) 11, 217, 231, 477
MboI GATC 4 cut(s) 9, 215, 229, 475
MluCI AATT 5 cut(s) 40, 49, 269, 487, 514
MlyI GAGTC 1 cut(s) 295
MnlI CCTC 2 cut(s) 257, 339
MseI TTAA 1 cut(s) 174
MslI CAYNNNNRTG 2 cut(s) 134, 406
MspI CCGG 1 cut(s) 185
MspR9I CCNGG 2 cut(s) 14, 185
MvaI CCWGG 1 cut(s) 14
NciI CCSGG 1 cut(s) 185
NdeII GATC 4 cut(s) 9, 215, 229, 475
NlaIII CATG 5 cut(s) 97, 133, 164, 405, 460
NmuCI GTSAC 2 cut(s) 136, 341
NspI RCATGY 2 cut(s) 164, 405
PciI ACATGT 2 cut(s) 160, 401
PflMI CCANNNNNTGG 1 cut(s) 291
PfoI TCCNGGA 1 cut(s) 183
PkrI GCNGC 1 cut(s) 483
PleI GAGTC 1 cut(s) 295
PpsI GAGTC 1 cut(s) 295
Ppu21I YACGTR 1 cut(s) 408
PscI ACATGT 2 cut(s) 160, 401
Psp6I CCWGG 1 cut(s) 12
PspGI CCWGG 1 cut(s) 12
PspPI GGNCC 3 cut(s) 187, 282, 428
RsaI GTAC 3 cut(s) 198, 406, 413
RsaNI GTAC 3 cut(s) 197, 405, 412
RseI CAYNNNNRTG 2 cut(s) 134, 406
SaqAI TTAA 1 cut(s) 174
SatI GCNGC 1 cut(s) 482
Sau3AI GATC 4 cut(s) 9, 215, 229, 475
Sau96I GGNCC 3 cut(s) 187, 282, 428
SchI GAGTC 1 cut(s) 295
ScrFI CCNGG 2 cut(s) 14, 185
SetI ASST 5 cut(s) 90, 249, 263, 397, 410
SfaNI GCATC 1 cut(s) 177
SinI GGWCC 2 cut(s) 187, 428
SmiMI CAYNNNNRTG 2 cut(s) 134, 406
Sse9I AATT 5 cut(s) 40, 49, 269, 487, 514
SsiI CCGC 1 cut(s) 482
StyD4I CCNGG 2 cut(s) 12, 183
TaaI ACNGT 6 cut(s) 22, 28, 212, 347, 383, 494
TaiI ACGT 1 cut(s) 410
TaqI TCGA 1 cut(s) 214
TasI AATT 5 cut(s) 40, 49, 269, 487, 514
TauI GCSGC 1 cut(s) 484
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TscAI CASTG 1 cut(s) 215
TseFI GTSAC 2 cut(s) 136, 341
Tsp45I GTSAC 2 cut(s) 136, 341
TspDTI ATGAA 4 cut(s) 118, 282, 335, 458
TspGWI ACGGA 3 cut(s) 124, 193, 420
TspRI CASTG 1 cut(s) 215
Van91I CCANNNNNTGG 1 cut(s) 291
VpaK11BI GGWCC 2 cut(s) 187, 428
XapI RAATTY 1 cut(s) 269
XceI RCATGY 2 cut(s) 164, 405
XcmI CCANNNNNNNNNTGG 2 cut(s) 463, 493
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.