FvH4_3g25180

Encoded by

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Reverse (-)
18162598 .. 18163011
414 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g25180.t1

Sequence Viewer

Length: 414 bp
ATGGCCACATTGTTTTGCAGAAGTATTGTTTTCCTGCCAATGGTGTTTATGTTGATGGTCCTAACCATGTCCGAAGCCAAAACACATGTTCGCATCATCAACAATTTACCGGACAACATGGACCTTACCGTTCATTGTAAATCCGGGGAAGATGATCTCGGCACCCAAGTGCTCTCCTACCTCAGCTCCTATGAATTTCGTTTCAATCCAAACATTTGGGGGACAACACAGTTTTACTGCTCTATGGCGTGGCCGTCAAACTTGCACTATTTTGATATCTACATTCACAGAAGGGATTACAAATGTTATTGGAGCAAACACGTTTGTATGTGGCGTGTAACACCACAAGGTCCCTGCGTAGTGACGGACCTGCCTAATAACAAGACCATTTGTTATGTCTGGAATAAAGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

138

Amino Acids

16.21

Weight (kDa)

7.6

Isoelectric Point (pI)

40.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 29 - 134 3.3e-27 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 378
AccB1I GGYRCC 1 cut(s) 161
AcoI YGGCCR 2 cut(s) 3, 251
AcsI RAATTY 1 cut(s) 194
AfiI CCNNNNNNNGG 1 cut(s) 40
AflIII ACRYGT 2 cut(s) 85, 319
AgsI TTSAA 1 cut(s) 205
AleI CACNNNNGTG 1 cut(s) 167
AluBI AGCT 1 cut(s) 186
AluI AGCT 1 cut(s) 186
Alw21I GWGCWC 1 cut(s) 174
AoxI GGCC 2 cut(s) 3, 251
ApoI RAATTY 1 cut(s) 194
AspS9I GGNCC 4 cut(s) 58, 121, 350, 367
AsuC2I CCSGG 1 cut(s) 145
AvaII GGWCC 4 cut(s) 58, 121, 350, 367
BalI TGGCCA 1 cut(s) 5
BanI GGYRCC 1 cut(s) 161
Bbv12I GWGCWC 1 cut(s) 174
BbvCI CCTCAGC 1 cut(s) 182
BccI CCATC 1 cut(s) 49
BceAI ACGGC 1 cut(s) 238
BcnI CCSGG 1 cut(s) 145
BfaI CTAG 1 cut(s) 412
BfuAI ACCTGC 1 cut(s) 378
Bme1390I CCNGG 1 cut(s) 145
Bme18I GGWCC 4 cut(s) 58, 121, 350, 367
BmgT120I GGNCC 4 cut(s) 58, 121, 350, 367
BmiI GGNNCC 2 cut(s) 163, 352
BmrFI CCNGG 1 cut(s) 145
BmsI GCATC 1 cut(s) 102
Bpu10I CCTNAGC 1 cut(s) 182
BpuMI CCSGG 1 cut(s) 145
BsaJI CCNNGG 1 cut(s) 144
BsaWI WCCGGW 1 cut(s) 109
BsaXI ACNNNNNCTCC 2 cut(s) 170, 200
Bsc4I CCNNNNNNNGG 1 cut(s) 40
BseDI CCNNGG 1 cut(s) 144
BseLI CCNNNNNNNGG 1 cut(s) 40
BseMII CTCAG 1 cut(s) 196
BshFI GGCC 2 cut(s) 5, 253
BshNI GGYRCC 1 cut(s) 161
BsiHKAI GWGCWC 1 cut(s) 174
BsiSI CCGG 2 cut(s) 110, 144
BslFI GGGAC 2 cut(s) 235, 336
BslI CCNNNNNNNGG 1 cut(s) 40
BsmFI GGGAC 2 cut(s) 235, 336
BsnI GGCC 2 cut(s) 5, 253
Bsp1286I GDGCHC 1 cut(s) 174
Bsp143I GATC 1 cut(s) 154
BspANI GGCC 2 cut(s) 5, 253
BspCNI CTCAG 1 cut(s) 195
BspLI GGNNCC 2 cut(s) 163, 352
BspMI ACCTGC 1 cut(s) 378
BspT107I GGYRCC 1 cut(s) 161
BssECI CCNNGG 1 cut(s) 144
BssMI GATC 1 cut(s) 154
Bst4CI ACNGT 2 cut(s) 130, 231
BstDEI CTNAG 1 cut(s) 182
BstKTI GATC 1 cut(s) 157
BstMBI GATC 1 cut(s) 154
BstNSI RCATGY 1 cut(s) 89
BstSCI CCNGG 1 cut(s) 143
BstXI CCANNNNNNTGG 1 cut(s) 216
BsuRI GGCC 2 cut(s) 5, 253
BveI ACCTGC 1 cut(s) 378
Cfr13I GGNCC 4 cut(s) 58, 121, 350, 367
CviAII CATG 3 cut(s) 67, 86, 118
CviJI RGCY 4 cut(s) 5, 77, 186, 253
CviKI_1 RGCY 4 cut(s) 5, 77, 186, 253
DdeI CTNAG 1 cut(s) 182
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
EaeI YGGCCR 2 cut(s) 3, 251
Eco32I GATATC 1 cut(s) 277
Eco47I GGWCC 4 cut(s) 58, 121, 350, 367
EcoO109I RGGNCCY 1 cut(s) 350
EcoRV GATATC 1 cut(s) 277
FaeI CATG 3 cut(s) 70, 89, 121
FaiI YATR 8 cut(s) 50, 68, 87, 119, 192, 245, 329, 396
FaqI GGGAC 2 cut(s) 235, 336
FatI CATG 3 cut(s) 66, 85, 117
FspBI CTAG 1 cut(s) 412
HaeIII GGCC 2 cut(s) 5, 253
HapII CCGG 2 cut(s) 110, 144
Hin1II CATG 3 cut(s) 70, 89, 121
HpaII CCGG 2 cut(s) 110, 144
Hpy188I TCNGA 1 cut(s) 73
Hpy188III TCNNGA 1 cut(s) 400
HpyAV CCTTC 1 cut(s) 285
HpyCH4III ACNGT 2 cut(s) 130, 231
HpyCH4IV ACGT 1 cut(s) 321
HpyCH4V TGCA 2 cut(s) 18, 265
HpyF3I CTNAG 1 cut(s) 182
HpySE526I ACGT 1 cut(s) 321
Hsp92II CATG 3 cut(s) 70, 89, 121
Kzo9I GATC 1 cut(s) 154
LmnI GCTCC 2 cut(s) 191, 312
LpnPI CCDG 6 cut(s) 47, 123, 157, 367, 383, 385
LweI GCATC 1 cut(s) 102
MaeI CTAG 1 cut(s) 412
MaeII ACGT 1 cut(s) 321
MaeIII GTNAC 2 cut(s) 337, 361
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MboII GAAGA 1 cut(s) 161
MhlI GDGCHC 1 cut(s) 174
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 103, 194
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 1 cut(s) 191
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MslI CAYNNNNRTG 1 cut(s) 167
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 2 cut(s) 110, 144
MspR9I CCNGG 1 cut(s) 145
NciI CCSGG 1 cut(s) 145
NdeII GATC 1 cut(s) 154
NlaIII CATG 3 cut(s) 70, 89, 121
NlaIV GGNNCC 2 cut(s) 163, 352
NmeAIII GCCGAG 1 cut(s) 138
NmuCI GTSAC 1 cut(s) 361
NspI RCATGY 1 cut(s) 89
OliI CACNNNNGTG 1 cut(s) 167
PciI ACATGT 1 cut(s) 85
PpuMI RGGWCCY 1 cut(s) 350
PscI ACATGT 1 cut(s) 85
Psp5II RGGWCCY 1 cut(s) 350
PspN4I GGNNCC 2 cut(s) 163, 352
PspPI GGNCC 4 cut(s) 58, 121, 350, 367
PspPPI RGGWCCY 1 cut(s) 350
RseI CAYNNNNRTG 1 cut(s) 167
Sau3AI GATC 1 cut(s) 154
Sau96I GGNCC 4 cut(s) 58, 121, 350, 367
ScrFI CCNGG 1 cut(s) 145
SduI GDGCHC 1 cut(s) 174
SetI ASST 6 cut(s) 126, 183, 188, 324, 352, 372
SfaNI GCATC 1 cut(s) 102
SinI GGWCC 4 cut(s) 58, 121, 350, 367
SmiMI CAYNNNNRTG 1 cut(s) 167
Sse9I AATT 2 cut(s) 103, 194
SspMI CTAG 1 cut(s) 412
StyD4I CCNGG 1 cut(s) 143
TaaI ACNGT 2 cut(s) 130, 231
TaiI ACGT 1 cut(s) 324
TasI AATT 2 cut(s) 103, 194
TseFI GTSAC 1 cut(s) 361
Tsp45I GTSAC 1 cut(s) 361
TspDTI ATGAA 2 cut(s) 122, 207
TspGWI ACGGA 1 cut(s) 380
VpaK11BI GGWCC 4 cut(s) 58, 121, 350, 367
XapI RAATTY 1 cut(s) 194
XceI RCATGY 1 cut(s) 89
XspI CTAG 1 cut(s) 412
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.