Prupe.1G062600_v2.0.a1

Encoded by

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0001549
Physical Location & Seq
Forward (+)
4458853 .. 4459233
381 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G062600.1

Sequence Viewer

Length: 381 bp
ATGGAGCGATGGATCATCATCATATCGTTGATTTTTGCACTGATTACCATGTGTGAGGGTACTATTTGTGGAATTATCAATGGCTTGGTTCCAAAGGCGGATGTTCTCGTTCATTGTAAATCCGAACAAGACGATCTTGGCGTTCACCTAATTCACTACAATGCTACCTATGAGTTTGAATTCAAGCCCAACATTTGGGGAACTACACAATTCTATTGCAGCTTTACGTGGCCATCCCGAATTGAATGGTTCGACATTTACAAACACCAGAGGGATGAACTGTTGTATTGTTTGTGGATGGTCAAGCCTGATGGTCCATGTAGGTACAATCGTTTCAGCAAGAGCTTTGCTGATTGCTATAAATGGAACAACAAAATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

127

Amino Acids

15.04

Weight (kDa)

6.4

Isoelectric Point (pI)

32.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 195
AciI CCGC 1 cut(s) 98
AclWI GGATC 1 cut(s) 20
AcoI YGGCCR 1 cut(s) 230
AcsI RAATTY 2 cut(s) 179, 375
AfaI GTAC 2 cut(s) 61, 326
AfiI CCNNNNNNNGG 1 cut(s) 195
AgsI TTSAA 3 cut(s) 179, 184, 245
AluBI AGCT 2 cut(s) 222, 345
AluI AGCT 2 cut(s) 222, 345
AlwI GGATC 1 cut(s) 20
AoxI GGCC 1 cut(s) 230
ApeKI GCWGC 1 cut(s) 219
ApoI RAATTY 2 cut(s) 179, 375
AspS9I GGNCC 1 cut(s) 314
AsuHPI GGTGA 1 cut(s) 137
AvaII GGWCC 1 cut(s) 314
BaeI ACNNNNGTAYC 2 cut(s) 316, 349
BalI TGGCCA 1 cut(s) 232
BbvI GCAGC 1 cut(s) 231
BccI CCATC 4 cut(s) 3, 241, 292, 305
BisI GCNGC 1 cut(s) 220
BlsI GCNGC 1 cut(s) 221
Bme18I GGWCC 1 cut(s) 314
BmgT120I GGNCC 1 cut(s) 314
BmiI GGNNCC 1 cut(s) 90
BsaAI YACGTR 1 cut(s) 228
BsaBI GATNNNNATC 1 cut(s) 17
Bsc4I CCNNNNNNNGG 1 cut(s) 195
Bse8I GATNNNNATC 1 cut(s) 17
BseGI GGATG 4 cut(s) 106, 233, 280, 303
BseJI GATNNNNATC 1 cut(s) 17
BseLI CCNNNNNNNGG 1 cut(s) 195
BseXI GCAGC 1 cut(s) 231
BshFI GGCC 1 cut(s) 232
BslI CCNNNNNNNGG 1 cut(s) 195
BsnI GGCC 1 cut(s) 232
Bsp143I GATC 2 cut(s) 12, 133
BspACI CCGC 1 cut(s) 98
BspANI GGCC 1 cut(s) 232
BspLI GGNNCC 1 cut(s) 90
BspPI GGATC 1 cut(s) 20
BssMI GATC 2 cut(s) 12, 133
Bst4CI ACNGT 1 cut(s) 282
BstBAI YACGTR 1 cut(s) 228
BstF5I GGATG 4 cut(s) 106, 233, 280, 303
BstKTI GATC 2 cut(s) 15, 136
BstMBI GATC 2 cut(s) 12, 133
BstV1I GCAGC 1 cut(s) 231
BsuRI GGCC 1 cut(s) 232
BtgZI GCGATG 1 cut(s) 22
BtsCI GGATG 4 cut(s) 106, 233, 280, 303
BtsIMutI CAGTG 1 cut(s) 38
Cfr13I GGNCC 1 cut(s) 314
Csp6I GTAC 2 cut(s) 60, 325
CviAII CATG 2 cut(s) 49, 318
CviJI RGCY 6 cut(s) 84, 187, 222, 232, 307, 345
CviKI_1 RGCY 6 cut(s) 84, 187, 222, 232, 307, 345
CviQI GTAC 2 cut(s) 60, 325
DpnI GATC 2 cut(s) 14, 135
DpnII GATC 2 cut(s) 12, 133
EaeI YGGCCR 1 cut(s) 230
EciI GGCGGA 1 cut(s) 113
Eco47I GGWCC 1 cut(s) 314
EcoRI GAATTC 1 cut(s) 179
FaeI CATG 2 cut(s) 52, 321
FaiI YATR 5 cut(s) 23, 50, 171, 319, 360
FalI AAGNNNNNCTT 2 cut(s) 120, 152
FatI CATG 2 cut(s) 48, 317
Fnu4HI GCNGC 1 cut(s) 220
FokI GGATG 4 cut(s) 113, 220, 287, 310
Fsp4HI GCNGC 1 cut(s) 220
GluI GCNGC 1 cut(s) 220
HaeIII GGCC 1 cut(s) 232
Hin1II CATG 2 cut(s) 52, 321
HphI GGTGA 1 cut(s) 137
Hpy166II GTNNAC 1 cut(s) 145
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 1 cut(s) 237
Hpy8I GTNNAC 1 cut(s) 145
HpyCH4III ACNGT 1 cut(s) 282
HpyCH4IV ACGT 1 cut(s) 227
HpyCH4V TGCA 2 cut(s) 38, 219
HpySE526I ACGT 1 cut(s) 227
Hsp92II CATG 2 cut(s) 52, 321
Kzo9I GATC 2 cut(s) 12, 133
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 2 cut(s) 281, 321
Lsp1109I GCAGC 1 cut(s) 231
MaeII ACGT 1 cut(s) 227
MalI GATC 2 cut(s) 14, 135
MboI GATC 2 cut(s) 12, 133
MlsI TGGCCA 1 cut(s) 232
MluCI AATT 6 cut(s) 72, 150, 179, 209, 240, 375
MluNI TGGCCA 1 cut(s) 232
MnlI CCTC 2 cut(s) 49, 264
Mox20I TGGCCA 1 cut(s) 232
MscI TGGCCA 1 cut(s) 232
MslI CAYNNNNRTG 1 cut(s) 159
Msp20I TGGCCA 1 cut(s) 232
NdeII GATC 2 cut(s) 12, 133
NlaIII CATG 2 cut(s) 52, 321
NlaIV GGNNCC 1 cut(s) 90
PcsI WCGNNNNNNNCGW 1 cut(s) 138
PflMI CCANNNNNTGG 1 cut(s) 195
PkrI GCNGC 1 cut(s) 221
Ppu21I YACGTR 1 cut(s) 228
PspN4I GGNNCC 1 cut(s) 90
PspPI GGNCC 1 cut(s) 314
RsaI GTAC 2 cut(s) 61, 326
RsaNI GTAC 2 cut(s) 60, 325
RseI CAYNNNNRTG 1 cut(s) 159
SatI GCNGC 1 cut(s) 220
Sau3AI GATC 2 cut(s) 12, 133
Sau96I GGNCC 1 cut(s) 314
SetI ASST 6 cut(s) 150, 170, 224, 230, 326, 347
SinI GGWCC 1 cut(s) 314
SmiMI CAYNNNNRTG 1 cut(s) 159
Sse9I AATT 6 cut(s) 72, 150, 179, 209, 240, 375
SsiI CCGC 1 cut(s) 98
TaaI ACNGT 1 cut(s) 282
TaiI ACGT 1 cut(s) 230
TaqI TCGA 1 cut(s) 252
TasI AATT 6 cut(s) 72, 150, 179, 209, 240, 375
TscAI CASTG 1 cut(s) 45
TseI GCWGC 1 cut(s) 219
TspDTI ATGAA 2 cut(s) 101, 291
TspRI CASTG 1 cut(s) 45
Van91I CCANNNNNTGG 1 cut(s) 195
VpaK11BI GGWCC 1 cut(s) 314
XapI RAATTY 2 cut(s) 179, 375
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.