Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp01

Orthogroup ID

OG0001549

Physical Location & Seq

Genomic Coordinates Forward (+)

4465594 .. 4465977

Gene Structure 384 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.1G062800.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 384 bp

ATGGAGCGATGGATCATCATCATATTGTTGATTTTTGCACTCATTACCACGTGTGAGGGTATGACTTGTGGAATTATCAATGGTTTACTGAATCCAAAGTCGGATGTTCTCGTTCATTGTAAATCCGAAAATGACGATCTTGGCGTTCACCAACTCCAGTACAATGCTAGCTTTGAGTTTCATTTCTCGCCCAACTTTTGGGGAACTACACAATTCTACTGCAGCTTTGTGTGGCCATCCCGAATTGAATGGTTCGACGTTTACAAACACAAGAGGGATGCATTTGATTTATGTTTGTGGATGGTCAAGCATGATGGTCCATGTAGGTTCGATCATGGCCACCAGAGCTTTGATGATTGCTTTAAATGGAACAACAGAATTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Self-incomp_S1

Protein Analysis

128

Amino Acids

15.1

Weight (kDa)

5.91

Isoelectric Point (pI)

38.38

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001549)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G04645
fragaria_vesca	FvH4_2g30460 FvH4_3g25180 FvH4_4g05600
malus_domestica	MD13G1228400.v1.1 MD13G1231600.v1.1 MD13G1231700.v1.1 MD14G1004300.v1.1
prunus_persica	Prupe.1G062000_v2.0.a1 Prupe.1G062100_v2.0.a1 Prupe.1G062300_v2.0.a1 Prupe.1G062400_v2.0.a1 Prupe.1G062500_v2.0.a1 Prupe.1G062600_v2.0.a1 Prupe.1G062700_v2.0.a1 Prupe.1G062800_v2.0.a1 Prupe.1G062900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr4g0397181 RchiOBHm_Chr4g0397201 RchiOBHm_Chr4g0397211 RchiOBHm_Chr5g0046141 RchiOBHm_Chr6g0244081 RchiOBHm_Chr6g0312461 RchiOBHm_Chr6g0312471
rosa_laevigata	RLG00000010327 RLG00000015384 RLG00000034380
rosa_multiflora	Rmu_co8450703.1_g000001 Rmu_sc0001035.1_g000059 Rmu_sc0002312.1_g000061 Rmu_sc0003094.1_g000020
rosa_roxburghii	Rroxscaffold_7G00216090
rosa_rugosa	Rorug03G0344000 Rorug03G0344100 Rorug05G0225200
rosa_samantha	Rh4CG083200 Rh4DG071200 Rh4DG071300 Rh5BG314500 Rh5CG341000 Rh5DG324800 Rh6AG021700 Rh6BG017400 Rh6CG014100 Rh6CG529900 Rh6DG015300 Rh7BG231700
rosa_wichuraiana	Rw4G006300 Rw5G028630 Rw6G044620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	198
AclWI	GGATC	1 cut(s)	20
AcoI	YGGCCR	2 cut(s)	233, 337
AcsI	RAATTY	1 cut(s)	378
AcvI	CACGTG	1 cut(s)	51
AfaI	GTAC	1 cut(s)	161
AfiI	CCNNNNNNNGG	1 cut(s)	198
AflIII	ACRYGT	1 cut(s)	50
AgsI	TTSAA	1 cut(s)	248
AluBI	AGCT	3 cut(s)	171, 225, 348
AluI	AGCT	3 cut(s)	171, 225, 348
AlwI	GGATC	1 cut(s)	20
AoxI	GGCC	2 cut(s)	233, 337
ApeKI	GCWGC	1 cut(s)	222
ApoI	RAATTY	1 cut(s)	378
AspS9I	GGNCC	1 cut(s)	317
AsuHPI	GGTGA	1 cut(s)	140
AsuNHI	GCTAGC	1 cut(s)	167
AvaII	GGWCC	1 cut(s)	317
BalI	TGGCCA	2 cut(s)	235, 339
BbrPI	CACGTG	1 cut(s)	51
BbvI	GCAGC	1 cut(s)	234
BccI	CCATC	4 cut(s)	3, 244, 295, 308
BfaI	CTAG	1 cut(s)	168
BfmI	CTRYAG	1 cut(s)	220
BisI	GCNGC	1 cut(s)	223
BlsI	GCNGC	1 cut(s)	224
Bme18I	GGWCC	1 cut(s)	317
BmgT120I	GGNCC	1 cut(s)	317
BmsI	GCATC	1 cut(s)	268
BmtI	GCTAGC	1 cut(s)	171
BpmI	CTGGAG	1 cut(s)	140
BsaAI	YACGTR	1 cut(s)	51
BsaBI	GATNNNNATC	1 cut(s)	17
Bsc4I	CCNNNNNNNGG	1 cut(s)	198
Bse1I	ACTGG	1 cut(s)	157
Bse8I	GATNNNNATC	1 cut(s)	17
BseGI	GGATG	4 cut(s)	109, 236, 283, 306
BseJI	GATNNNNATC	1 cut(s)	17
BseLI	CCNNNNNNNGG	1 cut(s)	198
BseNI	ACTGG	1 cut(s)	157
BseXI	GCAGC	1 cut(s)	234
BshFI	GGCC	2 cut(s)	235, 339
BslI	CCNNNNNNNGG	1 cut(s)	198
BsnI	GGCC	2 cut(s)	235, 339
Bsp143I	GATC	3 cut(s)	12, 136, 331
BspANI	GGCC	2 cut(s)	235, 339
BspMAI	CTGCAG	1 cut(s)	224
BspOI	GCTAGC	1 cut(s)	171
BspPI	GGATC	1 cut(s)	20
BsrI	ACTGG	1 cut(s)	157
BssMI	GATC	3 cut(s)	12, 136, 331
BstBAI	YACGTR	1 cut(s)	51
BstC8I	GCNNGC	1 cut(s)	169
BstF5I	GGATG	4 cut(s)	109, 236, 283, 306
BstKTI	GATC	3 cut(s)	15, 139, 334
BstMBI	GATC	3 cut(s)	12, 136, 331
BstMWI	GCNNNNNNNGC	1 cut(s)	345
BstSFI	CTRYAG	1 cut(s)	220
BstV1I	GCAGC	1 cut(s)	234
BsuRI	GGCC	2 cut(s)	235, 339
BtgZI	GCGATG	1 cut(s)	22
BtsCI	GGATG	4 cut(s)	109, 236, 283, 306
Cac8I	GCNNGC	1 cut(s)	169
Cfr13I	GGNCC	1 cut(s)	317
Csp6I	GTAC	1 cut(s)	160
CviAII	CATG	3 cut(s)	311, 321, 335
CviJI	RGCY	5 cut(s)	171, 225, 235, 339, 348
CviKI_1	RGCY	5 cut(s)	171, 225, 235, 339, 348
CviQI	GTAC	1 cut(s)	160
DpnI	GATC	3 cut(s)	14, 138, 333
DpnII	GATC	3 cut(s)	12, 136, 331
DraI	TTTAAA	1 cut(s)	364
EaeI	YGGCCR	2 cut(s)	233, 337
Eco47I	GGWCC	1 cut(s)	317
Eco72I	CACGTG	1 cut(s)	51
EcoT22I	ATGCAT	1 cut(s)	283
FaeI	CATG	3 cut(s)	314, 324, 338
FaiI	YATR	6 cut(s)	23, 62, 292, 312, 322, 336
FatI	CATG	3 cut(s)	310, 320, 334
Fnu4HI	GCNGC	1 cut(s)	223
FokI	GGATG	4 cut(s)	116, 223, 290, 313
Fsp4HI	GCNGC	1 cut(s)	223
FspBI	CTAG	1 cut(s)	168
GluI	GCNGC	1 cut(s)	223
GsuI	CTGGAG	1 cut(s)	140
HaeIII	GGCC	2 cut(s)	235, 339
Hin1II	CATG	3 cut(s)	314, 324, 338
HinfI	GANTC	1 cut(s)	91
HphI	GGTGA	1 cut(s)	140
Hpy166II	GTNNAC	3 cut(s)	86, 148, 262
Hpy188I	TCNGA	2 cut(s)	103, 127
Hpy188III	TCNNGA	1 cut(s)	240
Hpy8I	GTNNAC	3 cut(s)	86, 148, 262
Hpy99I	CGWCG	1 cut(s)	260
HpyCH4IV	ACGT	2 cut(s)	50, 258
HpyCH4V	TGCA	3 cut(s)	38, 222, 281
HpyF10VI	GCNNNNNNNGC	1 cut(s)	345
HpySE526I	ACGT	2 cut(s)	50, 258
Hsp92II	CATG	3 cut(s)	314, 324, 338
Kzo9I	GATC	3 cut(s)	12, 136, 331
LmnI	GCTCC	1 cut(s)	4
LpnPI	CCDG	2 cut(s)	170, 356
Lsp1109I	GCAGC	1 cut(s)	234
LweI	GCATC	1 cut(s)	268
MaeI	CTAG	1 cut(s)	168
MaeII	ACGT	2 cut(s)	50, 258
MalI	GATC	3 cut(s)	14, 138, 333
MboI	GATC	3 cut(s)	12, 136, 331
MlsI	TGGCCA	2 cut(s)	235, 339
MluCI	AATT	4 cut(s)	72, 212, 243, 378
MluNI	TGGCCA	2 cut(s)	235, 339
MmeI	TCCRAC	1 cut(s)	81
MnlI	CCTC	2 cut(s)	49, 267
Mox20I	TGGCCA	2 cut(s)	235, 339
Mph1103I	ATGCAT	1 cut(s)	283
MscI	TGGCCA	2 cut(s)	235, 339
MseI	TTAA	1 cut(s)	363
Msp20I	TGGCCA	2 cut(s)	235, 339
MwoI	GCNNNNNNNGC	1 cut(s)	345
NdeII	GATC	3 cut(s)	12, 136, 331
NheI	GCTAGC	1 cut(s)	167
NlaIII	CATG	3 cut(s)	314, 324, 338
NsiI	ATGCAT	1 cut(s)	283
PcsI	WCGNNNNNNNCGW	1 cut(s)	141
PfeI	GAWTC	1 cut(s)	91
PflMI	CCANNNNNTGG	1 cut(s)	198
PkrI	GCNGC	1 cut(s)	224
PmaCI	CACGTG	1 cut(s)	51
PmlI	CACGTG	1 cut(s)	51
Ppu21I	YACGTR	1 cut(s)	51
PspCI	CACGTG	1 cut(s)	51
PspPI	GGNCC	1 cut(s)	317
PstI	CTGCAG	1 cut(s)	224
RsaI	GTAC	1 cut(s)	161
RsaNI	GTAC	1 cut(s)	160
SaqAI	TTAA	1 cut(s)	363
SatI	GCNGC	1 cut(s)	223
Sau3AI	GATC	3 cut(s)	12, 136, 331
Sau96I	GGNCC	1 cut(s)	317
SetI	ASST	6 cut(s)	53, 173, 227, 261, 329, 350
SfaNI	GCATC	1 cut(s)	268
SfcI	CTRYAG	1 cut(s)	220
SinI	GGWCC	1 cut(s)	317
Sse9I	AATT	4 cut(s)	72, 212, 243, 378
SspMI	CTAG	1 cut(s)	168
TaiI	ACGT	2 cut(s)	53, 261
TaqI	TCGA	2 cut(s)	255, 330
TasI	AATT	4 cut(s)	72, 212, 243, 378
TatI	WGTACW	1 cut(s)	159
TfiI	GAWTC	1 cut(s)	91
Tru1I	TTAA	1 cut(s)	363
Tru9I	TTAA	1 cut(s)	363
TseI	GCWGC	1 cut(s)	222
TspDTI	ATGAA	2 cut(s)	104, 170
Van91I	CCANNNNNTGG	1 cut(s)	198
VpaK11BI	GGWCC	1 cut(s)	317
XapI	RAATTY	1 cut(s)	378
XspI	CTAG	1 cut(s)	168
Zsp2I	ATGCAT	1 cut(s)	283

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.