Rh5DG324800

Encoded by

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
42487182 .. 42487529
348 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG324800.1

Sequence Viewer

Length: 348 bp
ATGTCCGAAGCCAAAACACATGTTCGCATCACTAACGATTTACCAAACAACATGGACCTAACCGTTCATTGTAAATCCAGGGAAGACAACCTCGGCGCCCACGTACTCTCCTACCTCGACTCTTATGAATTTCGTTTCAATCCAAACATCGTGGGGTCAACTTTGTTTTACTGCTCTATGGCCTGGCCGTCACACACTCGCTATTTTAATATTTACAGTTTCAGAAGAGATGGCAGTTGTGAATGGAGCAAACATGTTTGTTTGTGGAGGGTAACACCAGAAGGTCCTTGCATAGTGAAGAACTTGAGTAATAACCAGACAGTTTGTTACAATTGGAAGAAAGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

115

Amino Acids

13.52

Weight (kDa)

8.24

Isoelectric Point (pI)

36.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 7 - 112 7.7e-28 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 95
AcoI YGGCCR 1 cut(s) 185
AcsI RAATTY 1 cut(s) 128
AcyI GRCGYC 1 cut(s) 96
AfaI GTAC 1 cut(s) 105
AflIII ACRYGT 2 cut(s) 19, 253
AgsI TTSAA 1 cut(s) 139
AjnI CCWGG 2 cut(s) 77, 182
AoxI GGCC 2 cut(s) 180, 185
ApoI RAATTY 1 cut(s) 128
AspLEI GCGC 1 cut(s) 98
AspS9I GGNCC 2 cut(s) 55, 284
AvaII GGWCC 2 cut(s) 55, 284
BanI GGYRCC 1 cut(s) 95
BbsI GAAGAC 1 cut(s) 90
BccI CCATC 1 cut(s) 224
BceAI ACGGC 1 cut(s) 172
BciT130I CCWGG 2 cut(s) 79, 184
BfoI RGCGCY 1 cut(s) 99
Bme1390I CCNGG 2 cut(s) 79, 184
Bme18I GGWCC 2 cut(s) 55, 284
BmgT120I GGNCC 2 cut(s) 55, 284
BmiI GGNNCC 1 cut(s) 97
BmrFI CCNGG 2 cut(s) 79, 184
BmsI GCATC 1 cut(s) 36
BpiI GAAGAC 1 cut(s) 90
BpuEI CTTGAG 1 cut(s) 325
BsaAI YACGTR 1 cut(s) 103
BsaHI GRCGYC 1 cut(s) 96
BsaJI CCNNGG 2 cut(s) 78, 91
BsaXI ACNNNNNCTCC 2 cut(s) 92, 122
BseBI CCWGG 2 cut(s) 79, 184
BseDI CCNNGG 2 cut(s) 78, 91
BshFI GGCC 2 cut(s) 182, 187
BshNI GGYRCC 1 cut(s) 95
BsnI GGCC 2 cut(s) 182, 187
BspANI GGCC 2 cut(s) 182, 187
BspLI GGNNCC 1 cut(s) 97
BspT107I GGYRCC 1 cut(s) 95
BssECI CCNNGG 2 cut(s) 78, 91
BssNI GRCGYC 1 cut(s) 96
Bst2UI CCWGG 2 cut(s) 79, 184
Bst4CI ACNGT 3 cut(s) 64, 218, 322
Bst6I CTCTTC 1 cut(s) 220
BstACI GRCGYC 1 cut(s) 96
BstBAI YACGTR 1 cut(s) 103
BstH2I RGCGCY 1 cut(s) 99
BstHHI GCGC 1 cut(s) 98
BstNI CCWGG 2 cut(s) 79, 184
BstNSI RCATGY 2 cut(s) 23, 257
BstSCI CCNGG 2 cut(s) 77, 182
BstV2I GAAGAC 1 cut(s) 90
BsuRI GGCC 2 cut(s) 182, 187
CfoI GCGC 1 cut(s) 98
Cfr13I GGNCC 2 cut(s) 55, 284
Csp6I GTAC 1 cut(s) 104
CspCI CAANNNNNGTGG 2 cut(s) 132, 167
CviAII CATG 3 cut(s) 20, 52, 254
CviJI RGCY 3 cut(s) 11, 182, 187
CviKI_1 RGCY 3 cut(s) 11, 182, 187
CviQI GTAC 1 cut(s) 104
DinI GGCGCC 1 cut(s) 97
EaeI YGGCCR 1 cut(s) 185
Eam1104I CTCTTC 1 cut(s) 220
EarI CTCTTC 1 cut(s) 220
Eco47I GGWCC 2 cut(s) 55, 284
EcoO109I RGGNCCY 1 cut(s) 284
EcoRII CCWGG 2 cut(s) 77, 182
EgeI GGCGCC 1 cut(s) 97
EheI GGCGCC 1 cut(s) 97
FaeI CATG 3 cut(s) 23, 55, 257
FaiI YATR 6 cut(s) 21, 53, 126, 179, 255, 293
FatI CATG 3 cut(s) 19, 51, 253
GlaI GCGC 1 cut(s) 97
HaeII RGCGCY 1 cut(s) 99
HaeIII GGCC 2 cut(s) 182, 187
HhaI GCGC 1 cut(s) 98
Hin1I GRCGYC 1 cut(s) 96
Hin1II CATG 3 cut(s) 23, 55, 257
Hin6I GCGC 1 cut(s) 96
HinP1I GCGC 1 cut(s) 96
HincII GTYRAC 1 cut(s) 159
HindII GTYRAC 1 cut(s) 159
HinfI GANTC 1 cut(s) 119
Hpy166II GTNNAC 1 cut(s) 159
Hpy188I TCNGA 2 cut(s) 7, 224
Hpy8I GTNNAC 1 cut(s) 159
HpyAV CCTTC 1 cut(s) 275
HpyCH4III ACNGT 3 cut(s) 64, 218, 322
HpyCH4IV ACGT 1 cut(s) 102
HpyCH4V TGCA 1 cut(s) 291
HpySE526I ACGT 1 cut(s) 102
Hsp92I GRCGYC 1 cut(s) 96
Hsp92II CATG 3 cut(s) 23, 55, 257
HspAI GCGC 1 cut(s) 96
KasI GGCGCC 1 cut(s) 95
LmnI GCTCC 1 cut(s) 246
LpnPI CCDG 6 cut(s) 64, 91, 169, 196, 291, 329
LweI GCATC 1 cut(s) 36
MaeII ACGT 1 cut(s) 102
MaeIII GTNAC 3 cut(s) 189, 271, 326
MboII GAAGA 3 cut(s) 95, 237, 310
MfeI CAATTG 1 cut(s) 331
MluCI AATT 2 cut(s) 128, 331
Mly113I GGCGCC 1 cut(s) 96
MlyI GAGTC 1 cut(s) 113
MnlI CCTC 3 cut(s) 101, 125, 261
MseI TTAA 1 cut(s) 207
MspR9I CCNGG 2 cut(s) 79, 184
MunI CAATTG 1 cut(s) 331
MvaI CCWGG 2 cut(s) 79, 184
NarI GGCGCC 1 cut(s) 96
NlaIII CATG 3 cut(s) 23, 55, 257
NlaIV GGNNCC 1 cut(s) 97
NmeAIII GCCGAG 1 cut(s) 72
NmuCI GTSAC 1 cut(s) 189
NspI RCATGY 2 cut(s) 23, 257
PciI ACATGT 2 cut(s) 19, 253
PcsI WCGNNNNNNNCGW 1 cut(s) 99
PleI GAGTC 1 cut(s) 113
PluTI GGCGCC 1 cut(s) 99
PpsI GAGTC 1 cut(s) 113
Ppu21I YACGTR 1 cut(s) 103
PpuMI RGGWCCY 1 cut(s) 284
PscI ACATGT 2 cut(s) 19, 253
Psp5II RGGWCCY 1 cut(s) 284
Psp6I CCWGG 2 cut(s) 77, 182
PspGI CCWGG 2 cut(s) 77, 182
PspN4I GGNNCC 1 cut(s) 97
PspPI GGNCC 2 cut(s) 55, 284
PspPPI RGGWCCY 1 cut(s) 284
RsaI GTAC 1 cut(s) 105
RsaNI GTAC 1 cut(s) 104
SaqAI TTAA 1 cut(s) 207
Sau96I GGNCC 2 cut(s) 55, 284
SchI GAGTC 1 cut(s) 113
ScrFI CCNGG 2 cut(s) 79, 184
SetI ASST 5 cut(s) 60, 93, 105, 117, 286
SfaNI GCATC 1 cut(s) 36
SfoI GGCGCC 1 cut(s) 97
SinI GGWCC 2 cut(s) 55, 284
SmlI CTYRAG 1 cut(s) 304
SmoI CTYRAG 1 cut(s) 304
Sse9I AATT 2 cut(s) 128, 331
SspDI GGCGCC 1 cut(s) 95
SspI AATATT 1 cut(s) 211
StyD4I CCNGG 2 cut(s) 77, 182
TaaI ACNGT 3 cut(s) 64, 218, 322
TaiI ACGT 1 cut(s) 105
TaqI TCGA 1 cut(s) 117
TasI AATT 2 cut(s) 128, 331
Tru1I TTAA 1 cut(s) 207
Tru9I TTAA 1 cut(s) 207
TseFI GTSAC 1 cut(s) 189
Tsp45I GTSAC 1 cut(s) 189
TspDTI ATGAA 2 cut(s) 56, 141
VpaK11BI GGWCC 2 cut(s) 55, 284
XapI RAATTY 1 cut(s) 128
XceI RCATGY 2 cut(s) 23, 257
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.