Rw4G006300

Encoded by

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
OG0001549
Physical Location & Seq
Reverse (-)
12897257 .. 12897655
399 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G006300.1

Sequence Viewer

Length: 399 bp
ATGAATCAGATATTGATAATATTGTTCATCCTATTGCTCACTAAGACTGAGGCTGCTTGGAATTCCAGACATGTTGAAATTATCAATGATTTCGGTCCAAATACATGTCTTACCATTCATTGCAAGTCTAAGGATGATGATCTGGGAGTCCATCTGCTTCAATTTCAAGAGTCCTATTGGATCCATTTCAAAATAAACATTTTCGGAGGTACACTATTTTTTTGCAGCTTCCAGTGGCCCGACAATTTTCATCACCTTGATGTTTACAATCAAGAGAGAGACAATGTACCCCCTAAAGAATGTAGGACATGCAGATACATGATCAGATCTGATGGTGGACATAGGTACAATGAGGAATTCCAAGATTTCACTGATTTTTTCAAGTGGAACGAAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

132

Amino Acids

15.9

Weight (kDa)

5.74

Isoelectric Point (pI)

41.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 24 - 129 8.8e-26 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 175, 188
AcsI RAATTY 2 cut(s) 61, 356
AfaI GTAC 3 cut(s) 211, 288, 347
AflIII ACRYGT 2 cut(s) 70, 104
AgsI TTSAA 5 cut(s) 77, 161, 167, 190, 382
AluBI AGCT 1 cut(s) 228
AluI AGCT 1 cut(s) 228
Alw26I GTCTC 1 cut(s) 273
AlwI GGATC 2 cut(s) 175, 188
AoxI GGCC 1 cut(s) 236
ApeKI GCWGC 2 cut(s) 53, 225
ApoI RAATTY 2 cut(s) 61, 356
AspS9I GGNCC 2 cut(s) 95, 237
AsuHPI GGTGA 1 cut(s) 245
AvaII GGWCC 1 cut(s) 95
BamHI GGATCC 1 cut(s) 180
BbvI GCAGC 2 cut(s) 40, 237
BccI CCATC 2 cut(s) 159, 326
BclI TGATCA 1 cut(s) 321
BcoDI GTCTC 1 cut(s) 273
BglII AGATCT 1 cut(s) 326
BisI GCNGC 2 cut(s) 54, 226
BlsI GCNGC 2 cut(s) 55, 227
Bme18I GGWCC 1 cut(s) 95
BmgT120I GGNCC 2 cut(s) 95, 237
BmiI GGNNCC 1 cut(s) 182
BsaBI GATNNNNATC 1 cut(s) 138
Bse1I ACTGG 1 cut(s) 232
Bse3DI GCAATG 1 cut(s) 118
Bse8I GATNNNNATC 1 cut(s) 138
BseGI GGATG 2 cut(s) 27, 139
BseJI GATNNNNATC 1 cut(s) 138
BseMI GCAATG 1 cut(s) 118
BseMII CTCAG 1 cut(s) 39
BseNI ACTGG 1 cut(s) 232
BseXI GCAGC 2 cut(s) 40, 237
BshFI GGCC 1 cut(s) 238
BsmAI GTCTC 1 cut(s) 273
BsnI GGCC 1 cut(s) 238
Bsp143I GATC 4 cut(s) 139, 180, 321, 326
BspANI GGCC 1 cut(s) 238
BspCNI CTCAG 1 cut(s) 40
BspLI GGNNCC 1 cut(s) 182
BspPI GGATC 2 cut(s) 175, 188
BsrDI GCAATG 1 cut(s) 118
BsrI ACTGG 1 cut(s) 232
BssMI GATC 4 cut(s) 139, 180, 321, 326
BstDEI CTNAG 3 cut(s) 42, 48, 129
BstF5I GGATG 2 cut(s) 27, 139
BstKTI GATC 4 cut(s) 142, 183, 324, 329
BstMAI GTCTC 1 cut(s) 273
BstMBI GATC 4 cut(s) 139, 180, 321, 326
BstNSI RCATGY 3 cut(s) 74, 108, 312
BstV1I GCAGC 2 cut(s) 40, 237
BstX2I RGATCY 2 cut(s) 180, 326
BstYI RGATCY 2 cut(s) 180, 326
BsuRI GGCC 1 cut(s) 238
BtsCI GGATG 2 cut(s) 27, 139
BtsIMutI CAGTG 2 cut(s) 239, 369
Cfr13I GGNCC 2 cut(s) 95, 237
Csp6I GTAC 3 cut(s) 210, 287, 346
CviAII CATG 4 cut(s) 71, 105, 309, 319
CviJI RGCY 3 cut(s) 53, 228, 238
CviKI_1 RGCY 3 cut(s) 53, 228, 238
CviQI GTAC 3 cut(s) 210, 287, 346
DdeI CTNAG 3 cut(s) 42, 48, 129
DpnI GATC 4 cut(s) 141, 182, 323, 328
DpnII GATC 4 cut(s) 139, 180, 321, 326
Eco47I GGWCC 1 cut(s) 95
EcoRI GAATTC 2 cut(s) 61, 356
FaeI CATG 4 cut(s) 74, 108, 312, 322
FaiI YATR 5 cut(s) 72, 106, 310, 320, 342
FatI CATG 4 cut(s) 70, 104, 308, 318
FbaI TGATCA 1 cut(s) 321
Fnu4HI GCNGC 2 cut(s) 54, 226
FokI GGATG 2 cut(s) 14, 146
Fsp4HI GCNGC 2 cut(s) 54, 226
GluI GCNGC 2 cut(s) 54, 226
HaeIII GGCC 1 cut(s) 238
Hin1II CATG 4 cut(s) 74, 108, 312, 322
HinfI GANTC 3 cut(s) 4, 147, 170
HphI GGTGA 1 cut(s) 245
Hpy166II GTNNAC 3 cut(s) 212, 265, 338
Hpy188I TCNGA 4 cut(s) 9, 206, 326, 331
Hpy188III TCNNGA 3 cut(s) 66, 167, 272
Hpy8I GTNNAC 3 cut(s) 212, 265, 338
HpyCH4V TGCA 3 cut(s) 123, 225, 312
HpyF3I CTNAG 3 cut(s) 42, 48, 129
Hsp92II CATG 4 cut(s) 74, 108, 312, 322
Ksp22I TGATCA 1 cut(s) 321
Kzo9I GATC 4 cut(s) 139, 180, 321, 326
LpnPI CCDG 3 cut(s) 79, 128, 245
Lsp1109I GCAGC 2 cut(s) 40, 237
MalI GATC 4 cut(s) 141, 182, 323, 328
MboI GATC 4 cut(s) 139, 180, 321, 326
MflI RGATCY 2 cut(s) 180, 326
MluCI AATT 5 cut(s) 61, 78, 161, 244, 356
MlyI GAGTC 2 cut(s) 156, 179
MnlI CCTC 3 cut(s) 43, 200, 346
MslI CAYNNNNRTG 1 cut(s) 258
NdeII GATC 4 cut(s) 139, 180, 321, 326
NlaIII CATG 4 cut(s) 74, 108, 312, 322
NlaIV GGNNCC 1 cut(s) 182
NspI RCATGY 3 cut(s) 74, 108, 312
PciI ACATGT 2 cut(s) 70, 104
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 2 cut(s) 55, 227
PleI GAGTC 2 cut(s) 155, 178
PpsI GAGTC 2 cut(s) 155, 178
PscI ACATGT 2 cut(s) 70, 104
PspN4I GGNNCC 1 cut(s) 182
PspPI GGNCC 2 cut(s) 95, 237
PsuI RGATCY 2 cut(s) 180, 326
RsaI GTAC 3 cut(s) 211, 288, 347
RsaNI GTAC 3 cut(s) 210, 287, 346
RseI CAYNNNNRTG 1 cut(s) 258
SatI GCNGC 2 cut(s) 54, 226
Sau3AI GATC 4 cut(s) 139, 180, 321, 326
Sau96I GGNCC 2 cut(s) 95, 237
SchI GAGTC 2 cut(s) 156, 179
SetI ASST 4 cut(s) 211, 230, 258, 347
SinI GGWCC 1 cut(s) 95
SmiMI CAYNNNNRTG 1 cut(s) 258
Sse9I AATT 5 cut(s) 61, 78, 161, 244, 356
SspI AATATT 1 cut(s) 21
TaqII GACCGA 1 cut(s) 83
TasI AATT 5 cut(s) 61, 78, 161, 244, 356
TfiI GAWTC 1 cut(s) 4
TscAI CASTG 2 cut(s) 239, 376
TseI GCWGC 2 cut(s) 53, 225
TspDTI ATGAA 4 cut(s) 16, 17, 107, 239
TspRI CASTG 2 cut(s) 239, 376
VpaK11BI GGWCC 1 cut(s) 95
XapI RAATTY 2 cut(s) 61, 356
XceI RCATGY 3 cut(s) 74, 108, 312
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.