Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp01

Orthogroup ID

OG0001549

Physical Location & Seq

Genomic Coordinates Forward (+)

4462999 .. 4463385

Gene Structure 387 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.1G062700.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 387 bp

ATGGAGCGATGGATCATCATCATATTGTTGCTTTTTGCACTGATTACCATGTGTAGTGGTAGACAACAAGTTTGTGGAATTATCAATGGTTTGGTTCCAGAATCGGATGTTCTTGTTCATTGTAAATCCAAACAAGACGATCTTGGCGTTCACCTACTTCACTACAATGCTCTCTATGAGTTTAAATTCAAGCCCAACTTTTGGGGAACTACACAATTCTACTGCAGCTTTACGTGGCCATCCCGAATTGAATGGTTCGACATTTACAAATTCCAGAGGGATGCAGGGAAGTTTTGTTACTGGATGATCAAGCCTGATGGTCCATGTAGGTACAATGGTCTCAGCAAGAGCTTTGATAAGTGCTATAAATGGAACCAAAAAATTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Self-incomp_S1

Protein Analysis

129

Amino Acids

15.28

Weight (kDa)

8.84

Isoelectric Point (pI)

24.08

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001549)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G04645
fragaria_vesca	FvH4_2g30460 FvH4_3g25180 FvH4_4g05600
malus_domestica	MD13G1228400.v1.1 MD13G1231600.v1.1 MD13G1231700.v1.1 MD14G1004300.v1.1
prunus_persica	Prupe.1G062000_v2.0.a1 Prupe.1G062100_v2.0.a1 Prupe.1G062300_v2.0.a1 Prupe.1G062400_v2.0.a1 Prupe.1G062500_v2.0.a1 Prupe.1G062600_v2.0.a1 Prupe.1G062700_v2.0.a1 Prupe.1G062800_v2.0.a1 Prupe.1G062900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr4g0397181 RchiOBHm_Chr4g0397201 RchiOBHm_Chr4g0397211 RchiOBHm_Chr5g0046141 RchiOBHm_Chr6g0244081 RchiOBHm_Chr6g0312461 RchiOBHm_Chr6g0312471
rosa_laevigata	RLG00000010327 RLG00000015384 RLG00000034380
rosa_multiflora	Rmu_co8450703.1_g000001 Rmu_sc0001035.1_g000059 Rmu_sc0002312.1_g000061 Rmu_sc0003094.1_g000020
rosa_roxburghii	Rroxscaffold_7G00216090
rosa_rugosa	Rorug03G0344000 Rorug03G0344100 Rorug05G0225200
rosa_samantha	Rh4CG083200 Rh4DG071200 Rh4DG071300 Rh5BG314500 Rh5CG341000 Rh5DG324800 Rh6AG021700 Rh6BG017400 Rh6CG014100 Rh6CG529900 Rh6DG015300 Rh7BG231700
rosa_wichuraiana	Rw4G006300 Rw5G028630 Rw6G044620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	201
AccI	GTMKAC	1 cut(s)	61
AclWI	GGATC	1 cut(s)	20
AcoI	YGGCCR	1 cut(s)	236
AcsI	RAATTY	3 cut(s)	185, 269, 381
AfaI	GTAC	1 cut(s)	332
AfiI	CCNNNNNNNGG	1 cut(s)	201
AgsI	TTSAA	2 cut(s)	190, 251
AluBI	AGCT	2 cut(s)	228, 351
AluI	AGCT	2 cut(s)	228, 351
Alw26I	GTCTC	1 cut(s)	344
AlwI	GGATC	1 cut(s)	20
AoxI	GGCC	1 cut(s)	236
ApeKI	GCWGC	1 cut(s)	225
ApoI	RAATTY	3 cut(s)	185, 269, 381
ArsI	GACNNNNNNTTYG	2 cut(s)	54, 86
AspS9I	GGNCC	1 cut(s)	320
AsuHPI	GGTGA	1 cut(s)	143
AvaII	GGWCC	1 cut(s)	320
BaeI	ACNNNNGTAYC	2 cut(s)	322, 355
BalI	TGGCCA	1 cut(s)	238
BarI	GAAGNNNNNNTAC	2 cut(s)	281, 313
BbvI	GCAGC	1 cut(s)	237
BccI	CCATC	3 cut(s)	3, 247, 311
BclI	TGATCA	1 cut(s)	306
BcoDI	GTCTC	1 cut(s)	344
BfmI	CTRYAG	1 cut(s)	223
BisI	GCNGC	1 cut(s)	226
BlsI	GCNGC	1 cut(s)	227
Bme18I	GGWCC	1 cut(s)	320
BmgT120I	GGNCC	1 cut(s)	320
BmiI	GGNNCC	2 cut(s)	96, 374
BmsI	GCATC	1 cut(s)	271
BsaAI	YACGTR	1 cut(s)	234
BsaBI	GATNNNNATC	1 cut(s)	17
BsaI	GGTCTC	1 cut(s)	344
Bsc4I	CCNNNNNNNGG	1 cut(s)	201
Bse1I	ACTGG	1 cut(s)	305
Bse8I	GATNNNNATC	1 cut(s)	17
BseGI	GGATG	4 cut(s)	112, 239, 286, 309
BseJI	GATNNNNATC	1 cut(s)	17
BseLI	CCNNNNNNNGG	1 cut(s)	201
BseMII	CTCAG	1 cut(s)	355
BseNI	ACTGG	1 cut(s)	305
BseXI	GCAGC	1 cut(s)	237
BshFI	GGCC	1 cut(s)	238
BslI	CCNNNNNNNGG	1 cut(s)	201
BsmAI	GTCTC	1 cut(s)	344
BsnI	GGCC	1 cut(s)	238
Bso31I	GGTCTC	1 cut(s)	344
Bsp143I	GATC	3 cut(s)	12, 139, 306
BspANI	GGCC	1 cut(s)	238
BspCNI	CTCAG	1 cut(s)	354
BspLI	GGNNCC	2 cut(s)	96, 374
BspMAI	CTGCAG	1 cut(s)	227
BspPI	GGATC	1 cut(s)	20
BspTNI	GGTCTC	1 cut(s)	344
BsrI	ACTGG	1 cut(s)	305
BssMI	GATC	3 cut(s)	12, 139, 306
BstBAI	YACGTR	1 cut(s)	234
BstDEI	CTNAG	1 cut(s)	341
BstF5I	GGATG	4 cut(s)	112, 239, 286, 309
BstKTI	GATC	3 cut(s)	15, 142, 309
BstMAI	GTCTC	1 cut(s)	344
BstMBI	GATC	3 cut(s)	12, 139, 306
BstSFI	CTRYAG	1 cut(s)	223
BstV1I	GCAGC	1 cut(s)	237
BsuRI	GGCC	1 cut(s)	238
BtgZI	GCGATG	1 cut(s)	22
BtsCI	GGATG	4 cut(s)	112, 239, 286, 309
BtsIMutI	CAGTG	1 cut(s)	38
Cfr13I	GGNCC	1 cut(s)	320
Csp6I	GTAC	1 cut(s)	331
CviAII	CATG	2 cut(s)	49, 324
CviJI	RGCY	5 cut(s)	193, 228, 238, 313, 351
CviKI_1	RGCY	5 cut(s)	193, 228, 238, 313, 351
CviQI	GTAC	1 cut(s)	331
DdeI	CTNAG	1 cut(s)	341
DpnI	GATC	3 cut(s)	14, 141, 308
DpnII	GATC	3 cut(s)	12, 139, 306
DraI	TTTAAA	1 cut(s)	184
EaeI	YGGCCR	1 cut(s)	236
Eco31I	GGTCTC	1 cut(s)	344
Eco47I	GGWCC	1 cut(s)	320
FaeI	CATG	2 cut(s)	52, 327
FaiI	YATR	5 cut(s)	23, 50, 177, 325, 366
FalI	AAGNNNNNCTT	4 cut(s)	126, 158, 182, 214
FatI	CATG	2 cut(s)	48, 323
FbaI	TGATCA	1 cut(s)	306
FblI	GTMKAC	1 cut(s)	61
Fnu4HI	GCNGC	1 cut(s)	226
FokI	GGATG	4 cut(s)	119, 226, 293, 316
Fsp4HI	GCNGC	1 cut(s)	226
GluI	GCNGC	1 cut(s)	226
HaeIII	GGCC	1 cut(s)	238
Hin1II	CATG	2 cut(s)	52, 327
HinfI	GANTC	1 cut(s)	101
HphI	GGTGA	1 cut(s)	143
Hpy166II	GTNNAC	2 cut(s)	62, 151
Hpy188I	TCNGA	1 cut(s)	106
Hpy188III	TCNNGA	3 cut(s)	98, 243, 274
Hpy8I	GTNNAC	2 cut(s)	62, 151
HpyCH4IV	ACGT	1 cut(s)	233
HpyCH4V	TGCA	3 cut(s)	38, 225, 284
HpyF3I	CTNAG	1 cut(s)	341
HpySE526I	ACGT	1 cut(s)	233
Hsp92II	CATG	2 cut(s)	52, 327
Ksp22I	TGATCA	1 cut(s)	306
Kzo9I	GATC	3 cut(s)	12, 139, 306
LmnI	GCTCC	1 cut(s)	4
LpnPI	CCDG	5 cut(s)	111, 270, 286, 287, 327
Lsp1109I	GCAGC	1 cut(s)	237
LweI	GCATC	1 cut(s)	271
MaeII	ACGT	1 cut(s)	233
MaeIII	GTNAC	1 cut(s)	296
MalI	GATC	3 cut(s)	14, 141, 308
MboI	GATC	3 cut(s)	12, 139, 306
MlsI	TGGCCA	1 cut(s)	238
MluCI	AATT	6 cut(s)	78, 185, 215, 246, 269, 381
MluNI	TGGCCA	1 cut(s)	238
MnlI	CCTC	1 cut(s)	270
Mox20I	TGGCCA	1 cut(s)	238
MscI	TGGCCA	1 cut(s)	238
MseI	TTAA	1 cut(s)	183
MslI	CAYNNNNRTG	1 cut(s)	165
Msp20I	TGGCCA	1 cut(s)	238
NdeII	GATC	3 cut(s)	12, 139, 306
NlaIII	CATG	2 cut(s)	52, 327
NlaIV	GGNNCC	2 cut(s)	96, 374
PcsI	WCGNNNNNNNCGW	1 cut(s)	144
PfeI	GAWTC	1 cut(s)	101
PflMI	CCANNNNNTGG	1 cut(s)	201
PkrI	GCNGC	1 cut(s)	227
Ppu21I	YACGTR	1 cut(s)	234
PspN4I	GGNNCC	2 cut(s)	96, 374
PspPI	GGNCC	1 cut(s)	320
PstI	CTGCAG	1 cut(s)	227
RsaI	GTAC	1 cut(s)	332
RsaNI	GTAC	1 cut(s)	331
RseI	CAYNNNNRTG	1 cut(s)	165
SaqAI	TTAA	1 cut(s)	183
SatI	GCNGC	1 cut(s)	226
Sau3AI	GATC	3 cut(s)	12, 139, 306
Sau96I	GGNCC	1 cut(s)	320
SetI	ASST	5 cut(s)	156, 230, 236, 332, 353
SfaNI	GCATC	1 cut(s)	271
SfcI	CTRYAG	1 cut(s)	223
SinI	GGWCC	1 cut(s)	320
SmiMI	CAYNNNNRTG	1 cut(s)	165
Sse9I	AATT	6 cut(s)	78, 185, 215, 246, 269, 381
TaiI	ACGT	1 cut(s)	236
TaqI	TCGA	1 cut(s)	258
TasI	AATT	6 cut(s)	78, 185, 215, 246, 269, 381
TfiI	GAWTC	1 cut(s)	101
Tru1I	TTAA	1 cut(s)	183
Tru9I	TTAA	1 cut(s)	183
TscAI	CASTG	1 cut(s)	45
TseI	GCWGC	1 cut(s)	225
TspDTI	ATGAA	1 cut(s)	107
TspRI	CASTG	1 cut(s)	45
Van91I	CCANNNNNTGG	1 cut(s)	201
VpaK11BI	GGWCC	1 cut(s)	320
XapI	RAATTY	3 cut(s)	185, 269, 381
XmiI	GTMKAC	1 cut(s)	61

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.