RchiOBHm_Chr4g0397181

Plant self-incompatibility protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0001549
Physical Location & Seq
Reverse (-)
13543200 .. 13543529
330 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36951

Sequence Viewer

Length: 330 bp
ATGAATCAGATATTGATAGTATTGTTCATCCTCTTGCTCACTAAGACTGAGGCTGGTGAGCGTTCCAAACATGTTGAAATTATCAATGATCTGGGTCCAAATACAGATCTTACCATTCATTGCAAGTCTAAGAATGACGATCTAGGAGTCCATCTGCTTCACTTTCAAGAGTCCTATTGGATCAATTTCAAAGTGAAATTGTTTGGAGGTACACTACTCTTTTGCAGCTTCCAATGGCCAGGCAGTTTTCATCACCTTGATATTTATGATCAAAAGAGGGACAATGTACCCCCTATTCCCCTAATGCATGTAAGACATGTCGATACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

109

Amino Acids

12.66

Weight (kDa)

6.42

Isoelectric Point (pI)

29.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 24 - 95 5.1e-21 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 188
AcoI YGGCCR 1 cut(s) 236
AfaI GTAC 2 cut(s) 211, 288
AflIII ACRYGT 2 cut(s) 70, 316
AgsI TTSAA 3 cut(s) 77, 167, 190
AjnI CCWGG 1 cut(s) 238
AluBI AGCT 1 cut(s) 228
AluI AGCT 1 cut(s) 228
AlwI GGATC 1 cut(s) 188
AoxI GGCC 1 cut(s) 236
ApeKI GCWGC 1 cut(s) 225
AspS9I GGNCC 1 cut(s) 95
AsuHPI GGTGA 2 cut(s) 68, 245
AvaII GGWCC 1 cut(s) 95
BalI TGGCCA 1 cut(s) 238
BbvI GCAGC 1 cut(s) 237
BccI CCATC 1 cut(s) 159
BciT130I CCWGG 1 cut(s) 240
BclI TGATCA 1 cut(s) 268
BfaI CTAG 1 cut(s) 143
BglII AGATCT 1 cut(s) 106
BisI GCNGC 1 cut(s) 226
BlsI GCNGC 1 cut(s) 227
Bme1390I CCNGG 1 cut(s) 240
Bme18I GGWCC 1 cut(s) 95
BmgT120I GGNCC 1 cut(s) 95
BmiI GGNNCC 1 cut(s) 96
BmrFI CCNGG 1 cut(s) 240
Bse3DI GCAATG 1 cut(s) 118
BseBI CCWGG 1 cut(s) 240
BseGI GGATG 1 cut(s) 27
BseMI GCAATG 1 cut(s) 118
BseMII CTCAG 1 cut(s) 39
BseXI GCAGC 1 cut(s) 237
BshFI GGCC 1 cut(s) 238
BslFI GGGAC 1 cut(s) 293
BsmFI GGGAC 1 cut(s) 293
BsnI GGCC 1 cut(s) 238
Bsp143I GATC 5 cut(s) 88, 106, 139, 180, 268
BspANI GGCC 1 cut(s) 238
BspCNI CTCAG 1 cut(s) 40
BspLI GGNNCC 1 cut(s) 96
BspPI GGATC 1 cut(s) 188
BsrDI GCAATG 1 cut(s) 118
BssMI GATC 5 cut(s) 88, 106, 139, 180, 268
Bst2UI CCWGG 1 cut(s) 240
BstDEI CTNAG 3 cut(s) 42, 48, 129
BstF5I GGATG 1 cut(s) 27
BstKTI GATC 5 cut(s) 91, 109, 142, 183, 271
BstMBI GATC 5 cut(s) 88, 106, 139, 180, 268
BstNI CCWGG 1 cut(s) 240
BstNSI RCATGY 3 cut(s) 74, 311, 320
BstSCI CCNGG 1 cut(s) 238
BstV1I GCAGC 1 cut(s) 237
BstX2I RGATCY 1 cut(s) 106
BstYI RGATCY 1 cut(s) 106
BsuRI GGCC 1 cut(s) 238
BtsCI GGATG 1 cut(s) 27
Cfr13I GGNCC 1 cut(s) 95
Csp6I GTAC 2 cut(s) 210, 287
CviAII CATG 4 cut(s) 71, 308, 317, 327
CviJI RGCY 3 cut(s) 53, 228, 238
CviKI_1 RGCY 3 cut(s) 53, 228, 238
CviQI GTAC 2 cut(s) 210, 287
DdeI CTNAG 3 cut(s) 42, 48, 129
DpnI GATC 5 cut(s) 90, 108, 141, 182, 270
DpnII GATC 5 cut(s) 88, 106, 139, 180, 268
EaeI YGGCCR 1 cut(s) 236
Eco47I GGWCC 1 cut(s) 95
EcoRII CCWGG 1 cut(s) 238
EcoT22I ATGCAT 1 cut(s) 309
FaeI CATG 4 cut(s) 74, 311, 320, 330
FaiI YATR 5 cut(s) 72, 267, 309, 318, 328
FaqI GGGAC 1 cut(s) 293
FatI CATG 4 cut(s) 70, 307, 316, 326
FbaI TGATCA 1 cut(s) 268
Fnu4HI GCNGC 1 cut(s) 226
FokI GGATG 1 cut(s) 14
Fsp4HI GCNGC 1 cut(s) 226
FspBI CTAG 1 cut(s) 143
GluI GCNGC 1 cut(s) 226
HaeIII GGCC 1 cut(s) 238
Hin1II CATG 4 cut(s) 74, 311, 320, 330
HinfI GANTC 3 cut(s) 4, 147, 170
HphI GGTGA 2 cut(s) 68, 245
Hpy166II GTNNAC 1 cut(s) 212
Hpy188I TCNGA 1 cut(s) 9
Hpy188III TCNNGA 1 cut(s) 167
Hpy8I GTNNAC 1 cut(s) 212
HpyCH4V TGCA 3 cut(s) 123, 225, 307
HpyF3I CTNAG 3 cut(s) 42, 48, 129
Hsp92II CATG 4 cut(s) 74, 311, 320, 330
Ksp22I TGATCA 1 cut(s) 268
Kzo9I GATC 5 cut(s) 88, 106, 139, 180, 268
LpnPI CCDG 4 cut(s) 39, 77, 225, 252
Lsp1109I GCAGC 1 cut(s) 237
MaeI CTAG 1 cut(s) 143
MalI GATC 5 cut(s) 90, 108, 141, 182, 270
MboI GATC 5 cut(s) 88, 106, 139, 180, 268
MflI RGATCY 1 cut(s) 106
MlsI TGGCCA 1 cut(s) 238
MluCI AATT 3 cut(s) 78, 184, 197
MluNI TGGCCA 1 cut(s) 238
MlyI GAGTC 2 cut(s) 156, 179
MnlI CCTC 4 cut(s) 41, 43, 200, 270
Mox20I TGGCCA 1 cut(s) 238
Mph1103I ATGCAT 1 cut(s) 309
MscI TGGCCA 1 cut(s) 238
Msp20I TGGCCA 1 cut(s) 238
MspR9I CCNGG 1 cut(s) 240
MvaI CCWGG 1 cut(s) 240
NdeII GATC 5 cut(s) 88, 106, 139, 180, 268
NlaIII CATG 4 cut(s) 74, 311, 320, 330
NlaIV GGNNCC 1 cut(s) 96
NsiI ATGCAT 1 cut(s) 309
NspI RCATGY 3 cut(s) 74, 311, 320
PciI ACATGT 2 cut(s) 70, 316
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 1 cut(s) 227
PleI GAGTC 2 cut(s) 155, 178
PpsI GAGTC 2 cut(s) 155, 178
PscI ACATGT 2 cut(s) 70, 316
Psp6I CCWGG 1 cut(s) 238
PspGI CCWGG 1 cut(s) 238
PspN4I GGNNCC 1 cut(s) 96
PspPI GGNCC 1 cut(s) 95
PsuI RGATCY 1 cut(s) 106
RsaI GTAC 2 cut(s) 211, 288
RsaNI GTAC 2 cut(s) 210, 287
SatI GCNGC 1 cut(s) 226
Sau3AI GATC 5 cut(s) 88, 106, 139, 180, 268
Sau96I GGNCC 1 cut(s) 95
SchI GAGTC 2 cut(s) 156, 179
ScrFI CCNGG 1 cut(s) 240
SetI ASST 3 cut(s) 211, 230, 258
SinI GGWCC 1 cut(s) 95
Sse9I AATT 3 cut(s) 78, 184, 197
SspMI CTAG 1 cut(s) 143
StyD4I CCNGG 1 cut(s) 238
TaqI TCGA 1 cut(s) 321
TasI AATT 3 cut(s) 78, 184, 197
TfiI GAWTC 1 cut(s) 4
TseI GCWGC 1 cut(s) 225
TspDTI ATGAA 4 cut(s) 16, 17, 107, 239
VpaK11BI GGWCC 1 cut(s) 95
XceI RCATGY 3 cut(s) 74, 311, 320
XspI CTAG 1 cut(s) 143
Zsp2I ATGCAT 1 cut(s) 309
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.