Rh6AG021700

Encoded by

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
2401228 .. 2401659
432 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG021700.1

Sequence Viewer

Length: 432 bp
ATGGCCTTGCTTACCAGAAAGGCAACATTGTTGCTAATGGTGTTGGTGTCAACGTTCCTAGCCATATGTGAAGCTAAAATTACTATTAGCATCAGTAACTTTTTGGCAGAGGAATATGAAGACGAAGTCAAGTTGGACCTCACTGTTCACTGTAAGTCCAAGGATGACGATCTCGGCCCCCATGTCCTCTCCTTCCTCGAAGGGTATGAGTTTCGGTTCAACCCCAACATTTGGCGGACAACGCTGTTTCACTGCACCATGGCATGGCCCTCTCATTTTCACCATTTCGTGATCTACGATCAATCAAGGGATGGAGGTTGTATACTAAACGACTCTCAGTGTATTTGGCGTGTAATAGAATCCGGTCCATGCAAATTAGAAACCTTGCCCAATAGGACAGAGATATGGGATTCTTATCCATGGAACAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

143

Amino Acids

16.63

Weight (kDa)

5.24

Isoelectric Point (pI)

37.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 43 - 131 1.9e-23 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 231, 264
AccI GTMKAC 1 cut(s) 322
AciI CCGC 1 cut(s) 235
AclI AACGTT 1 cut(s) 53
AfiI CCNNNNNNNGG 2 cut(s) 231, 264
AgsI TTSAA 1 cut(s) 220
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
AoxI GGCC 3 cut(s) 3, 175, 266
AspS9I GGNCC 4 cut(s) 136, 176, 267, 365
AsuHPI GGTGA 1 cut(s) 272
AvaII GGWCC 2 cut(s) 136, 365
BbsI GAAGAC 1 cut(s) 126
BccI CCATC 1 cut(s) 305
BfaI CTAG 2 cut(s) 59, 430
Bme18I GGWCC 2 cut(s) 136, 365
BmgT120I GGNCC 4 cut(s) 136, 176, 267, 365
BmiI GGNNCC 1 cut(s) 178
BmsI GCATC 1 cut(s) 99
BpiI GAAGAC 1 cut(s) 126
BsaBI GATNNNNATC 2 cut(s) 168, 414
BsaJI CCNNGG 3 cut(s) 159, 258, 419
BsaWI WCCGGW 1 cut(s) 362
Bsc4I CCNNNNNNNGG 2 cut(s) 231, 264
Bse8I GATNNNNATC 2 cut(s) 168, 414
BseDI CCNNGG 3 cut(s) 159, 258, 419
BseGI GGATG 2 cut(s) 169, 316
BseJI GATNNNNATC 2 cut(s) 168, 414
BseLI CCNNNNNNNGG 2 cut(s) 231, 264
BseMII CTCAG 1 cut(s) 350
BsgI GTGCAG 1 cut(s) 238
BshFI GGCC 3 cut(s) 5, 177, 268
BsiSI CCGG 1 cut(s) 363
BslI CCNNNNNNNGG 2 cut(s) 231, 264
BsnI GGCC 3 cut(s) 5, 177, 268
Bsp143I GATC 3 cut(s) 169, 291, 298
Bsp19I CCATGG 2 cut(s) 258, 419
BspACI CCGC 1 cut(s) 235
BspANI GGCC 3 cut(s) 5, 177, 268
BspCNI CTCAG 1 cut(s) 349
BspLI GGNNCC 1 cut(s) 178
BssECI CCNNGG 3 cut(s) 159, 258, 419
BssMI GATC 3 cut(s) 169, 291, 298
BssNAI GTATAC 1 cut(s) 323
BssT1I CCWWGG 3 cut(s) 159, 258, 419
Bst1107I GTATAC 1 cut(s) 323
Bst4CI ACNGT 2 cut(s) 145, 152
BstDEI CTNAG 1 cut(s) 336
BstDSI CCRYGG 2 cut(s) 258, 419
BstF5I GGATG 2 cut(s) 169, 316
BstKTI GATC 3 cut(s) 172, 294, 301
BstMBI GATC 3 cut(s) 169, 291, 298
BstMWI GCNNNNNNNGC 1 cut(s) 241
BstV2I GAAGAC 1 cut(s) 126
BstZ17I GTATAC 1 cut(s) 323
BsuRI GGCC 3 cut(s) 5, 177, 268
BtgI CCRYGG 2 cut(s) 258, 419
BtsCI GGATG 2 cut(s) 169, 316
BtsI GCAGTG 1 cut(s) 250
BtsIMutI CAGTG 4 cut(s) 141, 148, 250, 344
Cfr13I GGNCC 4 cut(s) 136, 176, 267, 365
CviAII CATG 5 cut(s) 182, 259, 264, 369, 420
CviJI RGCY 5 cut(s) 5, 62, 74, 177, 268
CviKI_1 RGCY 5 cut(s) 5, 62, 74, 177, 268
DdeI CTNAG 1 cut(s) 336
DpnI GATC 3 cut(s) 171, 293, 300
DpnII GATC 3 cut(s) 169, 291, 298
EciI GGCGGA 1 cut(s) 250
Eco130I CCWWGG 3 cut(s) 159, 258, 419
Eco47I GGWCC 2 cut(s) 136, 365
EcoT14I CCWWGG 3 cut(s) 159, 258, 419
ErhI CCWWGG 3 cut(s) 159, 258, 419
FaeI CATG 5 cut(s) 185, 262, 267, 372, 423
FatI CATG 5 cut(s) 181, 258, 263, 368, 419
FauNDI CATATG 1 cut(s) 65
FblI GTMKAC 1 cut(s) 322
FokI GGATG 2 cut(s) 176, 323
FspBI CTAG 2 cut(s) 59, 430
HaeIII GGCC 3 cut(s) 5, 177, 268
HapII CCGG 1 cut(s) 363
Hin1II CATG 5 cut(s) 185, 262, 267, 372, 423
HincII GTYRAC 1 cut(s) 51
HindII GTYRAC 1 cut(s) 51
HinfI GANTC 3 cut(s) 332, 359, 410
HpaII CCGG 1 cut(s) 363
HphI GGTGA 1 cut(s) 272
Hpy166II GTNNAC 3 cut(s) 51, 148, 323
Hpy188III TCNNGA 1 cut(s) 289
Hpy8I GTNNAC 3 cut(s) 51, 148, 323
HpyAV CCTTC 2 cut(s) 194, 202
HpyCH4III ACNGT 2 cut(s) 145, 152
HpyCH4IV ACGT 1 cut(s) 53
HpyCH4V TGCA 2 cut(s) 255, 372
HpyF10VI GCNNNNNNNGC 1 cut(s) 241
HpyF3I CTNAG 1 cut(s) 336
HpySE526I ACGT 1 cut(s) 53
Hsp92II CATG 5 cut(s) 185, 262, 267, 372, 423
Kzo9I GATC 3 cut(s) 169, 291, 298
LpnPI CCDG 2 cut(s) 28, 376
LweI GCATC 1 cut(s) 99
MaeI CTAG 2 cut(s) 59, 430
MaeII ACGT 1 cut(s) 53
MaeIII GTNAC 1 cut(s) 95
MalI GATC 3 cut(s) 171, 293, 300
MboI GATC 3 cut(s) 169, 291, 298
MboII GAAGA 1 cut(s) 131
MluCI AATT 2 cut(s) 78, 374
MlyI GAGTC 1 cut(s) 326
MmeI TCCRAC 1 cut(s) 114
MnlI CCTC 6 cut(s) 103, 149, 197, 206, 280, 308
MspI CCGG 1 cut(s) 363
MwoI GCNNNNNNNGC 1 cut(s) 241
NcoI CCATGG 2 cut(s) 258, 419
NdeI CATATG 1 cut(s) 65
NdeII GATC 3 cut(s) 169, 291, 298
NlaIII CATG 5 cut(s) 185, 262, 267, 372, 423
NlaIV GGNNCC 1 cut(s) 178
NmeAIII GCCGAG 1 cut(s) 153
PcsI WCGNNNNNNNCGW 1 cut(s) 294
PfeI GAWTC 2 cut(s) 359, 410
PflFI GACNNNGTC 1 cut(s) 125
PflMI CCANNNNNTGG 2 cut(s) 231, 264
PleI GAGTC 1 cut(s) 326
PpsI GAGTC 1 cut(s) 326
Psp1406I AACGTT 1 cut(s) 53
PspN4I GGNNCC 1 cut(s) 178
PspPI GGNCC 4 cut(s) 136, 176, 267, 365
PsyI GACNNNGTC 1 cut(s) 125
Sau3AI GATC 3 cut(s) 169, 291, 298
Sau96I GGNCC 4 cut(s) 136, 176, 267, 365
SchI GAGTC 1 cut(s) 326
SetI ASST 5 cut(s) 56, 76, 141, 319, 386
SfaNI GCATC 1 cut(s) 99
SinI GGWCC 2 cut(s) 136, 365
Sse9I AATT 2 cut(s) 78, 374
SsiI CCGC 1 cut(s) 235
SspMI CTAG 2 cut(s) 59, 430
StyI CCWWGG 3 cut(s) 159, 258, 419
TaaI ACNGT 2 cut(s) 145, 152
TaiI ACGT 1 cut(s) 56
TaqI TCGA 1 cut(s) 198
TasI AATT 2 cut(s) 78, 374
TfiI GAWTC 2 cut(s) 359, 410
TscAI CASTG 4 cut(s) 148, 155, 257, 344
TspDTI ATGAA 1 cut(s) 132
TspRI CASTG 4 cut(s) 148, 155, 257, 344
Tth111I GACNNNGTC 1 cut(s) 125
Van91I CCANNNNNTGG 2 cut(s) 231, 264
VpaK11BI GGWCC 2 cut(s) 136, 365
XmiI GTMKAC 1 cut(s) 322
XspI CTAG 2 cut(s) 59, 430
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.