Basic Information

Type: gene

Biological Identity

Species

rosa_laevigata

Chromosome

Chr3

Orthogroup ID

OG0001549

Physical Location & Seq

Genomic Coordinates Forward (+)

65337001 .. 65337432

Gene Structure 432 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

RLM00000015384

Sequence Viewer

CDS Protein Promoter (2k)

Length: 432 bp

ATGGCCTGGCTTACCAGAAAGGCAACATTGTTGCTAATGGTGTTGGTGATAACATTCCTAGCCATTTGTGAAGCTAAAATTACTGTTAGCATCAGTAACTTTTTGGCAGAGGAATATGAAGACGAAGCCAAGTTGGACCTAACTGTTCACTGCAAGTCCAAGGATGACGATCTCGGCCCCCATGTCCTCTCCTTCCTTGAAGGGTATGAGTTTCGGTTCAACCCCAACATTTGGCGGACAACGTTGTTTCACTGTAATATGGCATGGCCCTCTCATTTTCACCATTTCGTGATCTACGATCAATCAAGGGATGGAGGTTGTATAATAAACGACTCTCAGTGTATTTGGCGTGTAATAGAATCCGGTCCATGCAAATTAGAAACCTTGCCCAATAGGACAGAGATATGGGATTGTTATCCATGGAACAACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Self-incomp_S1

Protein Analysis

144

Amino Acids

16.71

Weight (kDa)

5.24

Isoelectric Point (pI)

33.86

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Self-incomp_S1	PF05938	29 - 141	4.4e-24	Plant self-incompatibility protein S1

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001549)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G04645
fragaria_vesca	FvH4_2g30460 FvH4_3g25180 FvH4_4g05600
malus_domestica	MD13G1228400.v1.1 MD13G1231600.v1.1 MD13G1231700.v1.1 MD14G1004300.v1.1
prunus_persica	Prupe.1G062000_v2.0.a1 Prupe.1G062100_v2.0.a1 Prupe.1G062300_v2.0.a1 Prupe.1G062400_v2.0.a1 Prupe.1G062500_v2.0.a1 Prupe.1G062600_v2.0.a1 Prupe.1G062700_v2.0.a1 Prupe.1G062800_v2.0.a1 Prupe.1G062900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr4g0397181 RchiOBHm_Chr4g0397201 RchiOBHm_Chr4g0397211 RchiOBHm_Chr5g0046141 RchiOBHm_Chr6g0244081 RchiOBHm_Chr6g0312461 RchiOBHm_Chr6g0312471
rosa_laevigata	RLG00000010327 RLG00000015384 RLG00000034380
rosa_multiflora	Rmu_co8450703.1_g000001 Rmu_sc0001035.1_g000059 Rmu_sc0002312.1_g000061 Rmu_sc0003094.1_g000020
rosa_roxburghii	Rroxscaffold_7G00216090
rosa_rugosa	Rorug03G0344000 Rorug03G0344100 Rorug05G0225200
rosa_samantha	Rh4CG083200 Rh4DG071200 Rh4DG071300 Rh5BG314500 Rh5CG341000 Rh5DG324800 Rh6AG021700 Rh6BG017400 Rh6CG014100 Rh6CG529900 Rh6DG015300 Rh7BG231700
rosa_wichuraiana	Rw4G006300 Rw5G028630 Rw6G044620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	231
AciI	CCGC	1 cut(s)	235
AclI	AACGTT	1 cut(s)	242
AfiI	CCNNNNNNNGG	1 cut(s)	231
AgsI	TTSAA	2 cut(s)	200, 220
AjnI	CCWGG	1 cut(s)	5
AluBI	AGCT	1 cut(s)	74
AluI	AGCT	1 cut(s)	74
AoxI	GGCC	3 cut(s)	3, 175, 266
AspS9I	GGNCC	4 cut(s)	136, 176, 267, 365
AsuHPI	GGTGA	2 cut(s)	58, 272
AvaII	GGWCC	2 cut(s)	136, 365
BbsI	GAAGAC	1 cut(s)	126
BccI	CCATC	1 cut(s)	305
BciT130I	CCWGG	1 cut(s)	7
BfaI	CTAG	2 cut(s)	59, 430
Bme1390I	CCNGG	1 cut(s)	7
Bme18I	GGWCC	2 cut(s)	136, 365
BmgT120I	GGNCC	4 cut(s)	136, 176, 267, 365
BmiI	GGNNCC	1 cut(s)	178
BmrFI	CCNGG	1 cut(s)	7
BmsI	GCATC	1 cut(s)	99
BpiI	GAAGAC	1 cut(s)	126
BsaBI	GATNNNNATC	2 cut(s)	168, 414
BsaJI	CCNNGG	2 cut(s)	159, 419
BsaWI	WCCGGW	1 cut(s)	362
Bsc4I	CCNNNNNNNGG	1 cut(s)	231
Bse8I	GATNNNNATC	2 cut(s)	168, 414
BseBI	CCWGG	1 cut(s)	7
BseDI	CCNNGG	2 cut(s)	159, 419
BseGI	GGATG	2 cut(s)	169, 316
BseJI	GATNNNNATC	2 cut(s)	168, 414
BseLI	CCNNNNNNNGG	1 cut(s)	231
BseMII	CTCAG	1 cut(s)	350
BshFI	GGCC	3 cut(s)	5, 177, 268
BsiSI	CCGG	1 cut(s)	363
BslI	CCNNNNNNNGG	1 cut(s)	231
BsnI	GGCC	3 cut(s)	5, 177, 268
Bsp143I	GATC	3 cut(s)	169, 291, 298
Bsp19I	CCATGG	1 cut(s)	419
BspACI	CCGC	1 cut(s)	235
BspANI	GGCC	3 cut(s)	5, 177, 268
BspCNI	CTCAG	1 cut(s)	349
BspLI	GGNNCC	1 cut(s)	178
BssECI	CCNNGG	2 cut(s)	159, 419
BssMI	GATC	3 cut(s)	169, 291, 298
BssT1I	CCWWGG	2 cut(s)	159, 419
Bst2UI	CCWGG	1 cut(s)	7
Bst4CI	ACNGT	3 cut(s)	85, 145, 254
BstDEI	CTNAG	1 cut(s)	336
BstDSI	CCRYGG	1 cut(s)	419
BstF5I	GGATG	2 cut(s)	169, 316
BstKTI	GATC	3 cut(s)	172, 294, 301
BstMBI	GATC	3 cut(s)	169, 291, 298
BstNI	CCWGG	1 cut(s)	7
BstSCI	CCNGG	1 cut(s)	5
BstV2I	GAAGAC	1 cut(s)	126
BsuRI	GGCC	3 cut(s)	5, 177, 268
BtgI	CCRYGG	1 cut(s)	419
BtsCI	GGATG	2 cut(s)	169, 316
BtsI	GCAGTG	1 cut(s)	148
BtsIMutI	CAGTG	3 cut(s)	148, 250, 344
Cfr13I	GGNCC	4 cut(s)	136, 176, 267, 365
CviAII	CATG	4 cut(s)	182, 264, 369, 420
CviJI	RGCY	7 cut(s)	5, 10, 62, 74, 128, 177, 268
CviKI_1	RGCY	7 cut(s)	5, 10, 62, 74, 128, 177, 268
DdeI	CTNAG	1 cut(s)	336
DpnI	GATC	3 cut(s)	171, 293, 300
DpnII	GATC	3 cut(s)	169, 291, 298
EciI	GGCGGA	1 cut(s)	250
Eco130I	CCWWGG	2 cut(s)	159, 419
Eco47I	GGWCC	2 cut(s)	136, 365
EcoRII	CCWGG	1 cut(s)	5
EcoT14I	CCWWGG	2 cut(s)	159, 419
ErhI	CCWWGG	2 cut(s)	159, 419
FaeI	CATG	4 cut(s)	185, 267, 372, 423
FaiI	YATR	9 cut(s)	117, 183, 207, 260, 265, 323, 370, 406, 421
FatI	CATG	4 cut(s)	181, 263, 368, 419
FokI	GGATG	2 cut(s)	176, 323
FspBI	CTAG	2 cut(s)	59, 430
HaeIII	GGCC	3 cut(s)	5, 177, 268
HapII	CCGG	1 cut(s)	363
Hin1II	CATG	4 cut(s)	185, 267, 372, 423
HinfI	GANTC	2 cut(s)	332, 359
HpaII	CCGG	1 cut(s)	363
HphI	GGTGA	2 cut(s)	58, 272
Hpy166II	GTNNAC	1 cut(s)	148
Hpy188III	TCNNGA	1 cut(s)	289
Hpy8I	GTNNAC	1 cut(s)	148
HpyAV	CCTTC	2 cut(s)	194, 202
HpyCH4III	ACNGT	3 cut(s)	85, 145, 254
HpyCH4IV	ACGT	1 cut(s)	242
HpyCH4V	TGCA	2 cut(s)	153, 372
HpyF3I	CTNAG	1 cut(s)	336
HpySE526I	ACGT	1 cut(s)	242
Hsp92II	CATG	4 cut(s)	185, 267, 372, 423
Kzo9I	GATC	3 cut(s)	169, 291, 298
LpnPI	CCDG	3 cut(s)	19, 28, 376
LweI	GCATC	1 cut(s)	99
MaeI	CTAG	2 cut(s)	59, 430
MaeII	ACGT	1 cut(s)	242
MaeIII	GTNAC	1 cut(s)	95
MalI	GATC	3 cut(s)	171, 293, 300
MboI	GATC	3 cut(s)	169, 291, 298
MboII	GAAGA	1 cut(s)	131
MluCI	AATT	2 cut(s)	78, 374
MlyI	GAGTC	1 cut(s)	326
MmeI	TCCRAC	1 cut(s)	114
MnlI	CCTC	4 cut(s)	103, 197, 280, 308
MspI	CCGG	1 cut(s)	363
MspR9I	CCNGG	1 cut(s)	7
MvaI	CCWGG	1 cut(s)	7
NcoI	CCATGG	1 cut(s)	419
NdeII	GATC	3 cut(s)	169, 291, 298
NlaIII	CATG	4 cut(s)	185, 267, 372, 423
NlaIV	GGNNCC	1 cut(s)	178
NmeAIII	GCCGAG	1 cut(s)	153
PcsI	WCGNNNNNNNCGW	1 cut(s)	294
PfeI	GAWTC	1 cut(s)	359
PflMI	CCANNNNNTGG	1 cut(s)	231
PleI	GAGTC	1 cut(s)	326
PpsI	GAGTC	1 cut(s)	326
Psp1406I	AACGTT	1 cut(s)	242
Psp6I	CCWGG	1 cut(s)	5
PspGI	CCWGG	1 cut(s)	5
PspN4I	GGNNCC	1 cut(s)	178
PspPI	GGNCC	4 cut(s)	136, 176, 267, 365
Sau3AI	GATC	3 cut(s)	169, 291, 298
Sau96I	GGNCC	4 cut(s)	136, 176, 267, 365
SchI	GAGTC	1 cut(s)	326
ScrFI	CCNGG	1 cut(s)	7
SetI	ASST	5 cut(s)	76, 141, 245, 319, 386
SfaNI	GCATC	1 cut(s)	99
SinI	GGWCC	2 cut(s)	136, 365
Sse9I	AATT	2 cut(s)	78, 374
SsiI	CCGC	1 cut(s)	235
SspMI	CTAG	2 cut(s)	59, 430
StyD4I	CCNGG	1 cut(s)	5
StyI	CCWWGG	2 cut(s)	159, 419
TaaI	ACNGT	3 cut(s)	85, 145, 254
TaiI	ACGT	1 cut(s)	245
TasI	AATT	2 cut(s)	78, 374
TfiI	GAWTC	1 cut(s)	359
TscAI	CASTG	3 cut(s)	155, 257, 344
TspDTI	ATGAA	1 cut(s)	132
TspRI	CASTG	3 cut(s)	155, 257, 344
Van91I	CCANNNNNTGG	1 cut(s)	231
VpaK11BI	GGWCC	2 cut(s)	136, 365
XspI	CTAG	2 cut(s)	59, 430

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.