Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp01

Orthogroup ID

OG0001549

Physical Location & Seq

Genomic Coordinates Forward (+)

4435364 .. 4435810

Gene Structure 447 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.1G062000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 447 bp

ATGATGAATCAATTGAGGGTGTTACTAGTGACATTTTTACTCGCAGCTATTGGTGTGGCTGCATTGCGTGACACACATGTCGGACTTAGCGACGGCATTCTTAACAGGCATGTTAATATTACCAACGGTCTAGGTCCAGAAGTGGATCTTACTGTTCATTGTAAGTCCGCAGATGACGATCTAGGAAAACAACTGATTCATTATGGCTCTACCTATGGGTTTCATTTCAGAGTTAACATTTTTGGGGGTACACAATTCTATTGCAGCTTTAAGTGGCCTGGGCAATTCCATTGGTTTGACATTTTCATACAAGCTAGAGATCACTGCAAGAATTGTCCGTGGTTGATCAAAGCTGACGGTCCACGCAGATTTAACAGTGAAACTGGTAATTATGATGATGTATATAAGTGGAACAAGCCCAGTAAATTTGTGTTGACGCATGGCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Self-incomp_S1

Protein Analysis

149

Amino Acids

16.87

Weight (kDa)

8.38

Isoelectric Point (pI)

27.29

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001549)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G04645
fragaria_vesca	FvH4_2g30460 FvH4_3g25180 FvH4_4g05600
malus_domestica	MD13G1228400.v1.1 MD13G1231600.v1.1 MD13G1231700.v1.1 MD14G1004300.v1.1
prunus_persica	Prupe.1G062000_v2.0.a1 Prupe.1G062100_v2.0.a1 Prupe.1G062300_v2.0.a1 Prupe.1G062400_v2.0.a1 Prupe.1G062500_v2.0.a1 Prupe.1G062600_v2.0.a1 Prupe.1G062700_v2.0.a1 Prupe.1G062800_v2.0.a1 Prupe.1G062900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr4g0397181 RchiOBHm_Chr4g0397201 RchiOBHm_Chr4g0397211 RchiOBHm_Chr5g0046141 RchiOBHm_Chr6g0244081 RchiOBHm_Chr6g0312461 RchiOBHm_Chr6g0312471
rosa_laevigata	RLG00000010327 RLG00000015384 RLG00000034380
rosa_multiflora	Rmu_co8450703.1_g000001 Rmu_sc0001035.1_g000059 Rmu_sc0002312.1_g000061 Rmu_sc0003094.1_g000020
rosa_roxburghii	Rroxscaffold_7G00216090
rosa_rugosa	Rorug03G0344000 Rorug03G0344100 Rorug05G0225200
rosa_samantha	Rh4CG083200 Rh4DG071200 Rh4DG071300 Rh5BG314500 Rh5CG341000 Rh5DG324800 Rh6AG021700 Rh6BG017400 Rh6CG014100 Rh6CG529900 Rh6DG015300 Rh7BG231700
rosa_wichuraiana	Rw4G006300 Rw5G028630 Rw6G044620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	77
AciI	CCGC	1 cut(s)	168
AclWI	GGATC	1 cut(s)	153
AcsI	RAATTY	1 cut(s)	425
AfaI	GTAC	1 cut(s)	250
AflIII	ACRYGT	1 cut(s)	76
AhlI	ACTAGT	1 cut(s)	25
AjnI	CCWGG	1 cut(s)	277
AluBI	AGCT	4 cut(s)	47, 267, 314, 353
AluI	AGCT	4 cut(s)	47, 267, 314, 353
AlwI	GGATC	1 cut(s)	153
AoxI	GGCC	1 cut(s)	275
ApeKI	GCWGC	3 cut(s)	44, 59, 264
ApoI	RAATTY	1 cut(s)	425
AspS9I	GGNCC	2 cut(s)	134, 359
AvaII	GGWCC	2 cut(s)	134, 359
BbvI	GCAGC	3 cut(s)	46, 56, 276
BceAI	ACGGC	1 cut(s)	109
BciT130I	CCWGG	1 cut(s)	279
BclI	TGATCA	1 cut(s)	345
BcuI	ACTAGT	1 cut(s)	25
BfaI	CTAG	5 cut(s)	26, 131, 182, 315, 445
BisI	GCNGC	3 cut(s)	45, 60, 265
BlsI	GCNGC	3 cut(s)	46, 61, 266
Bme1390I	CCNGG	1 cut(s)	279
Bme18I	GGWCC	2 cut(s)	134, 359
BmgT120I	GGNCC	2 cut(s)	134, 359
BmrFI	CCNGG	1 cut(s)	279
BmrI	ACTGGG	1 cut(s)	414
BmuI	ACTGGG	1 cut(s)	414
BsaBI	GATNNNNATC	1 cut(s)	177
BsaJI	CCNNGG	2 cut(s)	278, 338
Bse1I	ACTGG	2 cut(s)	388, 420
Bse3DI	GCAATG	1 cut(s)	62
Bse8I	GATNNNNATC	1 cut(s)	177
BseBI	CCWGG	1 cut(s)	279
BseDI	CCNNGG	2 cut(s)	278, 338
BseJI	GATNNNNATC	1 cut(s)	177
BseMI	GCAATG	1 cut(s)	62
BseNI	ACTGG	2 cut(s)	388, 420
BseXI	GCAGC	3 cut(s)	46, 56, 276
BshFI	GGCC	1 cut(s)	277
BsmI	GAATGC	1 cut(s)	96
BsnI	GGCC	1 cut(s)	277
Bsp143I	GATC	4 cut(s)	145, 178, 319, 345
BspACI	CCGC	1 cut(s)	168
BspANI	GGCC	1 cut(s)	277
BspPI	GGATC	1 cut(s)	153
BsrDI	GCAATG	1 cut(s)	62
BsrI	ACTGG	2 cut(s)	388, 420
BssECI	CCNNGG	2 cut(s)	278, 338
BssMI	GATC	4 cut(s)	145, 178, 319, 345
Bst2UI	CCWGG	1 cut(s)	279
Bst4CI	ACNGT	4 cut(s)	128, 154, 359, 377
BstDEI	CTNAG	1 cut(s)	86
BstDSI	CCRYGG	1 cut(s)	338
BstKTI	GATC	4 cut(s)	148, 181, 322, 348
BstMBI	GATC	4 cut(s)	145, 178, 319, 345
BstNI	CCWGG	1 cut(s)	279
BstNSI	RCATGY	2 cut(s)	80, 113
BstSCI	CCNGG	1 cut(s)	277
BstV1I	GCAGC	3 cut(s)	46, 56, 276
BstX2I	RGATCY	1 cut(s)	145
BstYI	RGATCY	1 cut(s)	145
BsuRI	GGCC	1 cut(s)	277
BtgI	CCRYGG	1 cut(s)	338
BtsI	GCAGTG	1 cut(s)	322
BtsIMutI	CAGTG	2 cut(s)	322, 382
Cfr13I	GGNCC	2 cut(s)	134, 359
Csp6I	GTAC	1 cut(s)	249
CviAII	CATG	3 cut(s)	77, 110, 440
CviJI	RGCY	9 cut(s)	47, 59, 207, 267, 277, 314, 353, 418, 444
CviKI_1	RGCY	9 cut(s)	47, 59, 207, 267, 277, 314, 353, 418, 444
CviQI	GTAC	1 cut(s)	249
DdeI	CTNAG	1 cut(s)	86
DpnI	GATC	4 cut(s)	147, 180, 321, 347
DpnII	GATC	4 cut(s)	145, 178, 319, 345
DrdI	GACNNNNNNGTC	1 cut(s)	77
DseDI	GACNNNNNNGTC	1 cut(s)	77
Eco47I	GGWCC	2 cut(s)	134, 359
EcoRII	CCWGG	1 cut(s)	277
FaeI	CATG	3 cut(s)	80, 113, 443
FaiI	YATR	9 cut(s)	78, 111, 204, 216, 308, 393, 403, 405, 441
FalI	AAGNNNNNCTT	2 cut(s)	132, 164
FatI	CATG	3 cut(s)	76, 109, 439
FbaI	TGATCA	1 cut(s)	345
Fnu4HI	GCNGC	3 cut(s)	45, 60, 265
Fsp4HI	GCNGC	3 cut(s)	45, 60, 265
FspBI	CTAG	5 cut(s)	26, 131, 182, 315, 445
GluI	GCNGC	3 cut(s)	45, 60, 265
HaeIII	GGCC	1 cut(s)	277
Hin1II	CATG	3 cut(s)	80, 113, 443
HincII	GTYRAC	2 cut(s)	235, 435
HindII	GTYRAC	2 cut(s)	235, 435
HinfI	GANTC	2 cut(s)	7, 196
HpaI	GTTAAC	1 cut(s)	235
Hpy166II	GTNNAC	4 cut(s)	235, 251, 362, 435
Hpy188I	TCNGA	2 cut(s)	83, 230
Hpy188III	TCNNGA	1 cut(s)	137
Hpy8I	GTNNAC	4 cut(s)	235, 251, 362, 435
Hpy99I	CGWCG	1 cut(s)	95
HpyCH4III	ACNGT	4 cut(s)	128, 154, 359, 377
HpyCH4V	TGCA	3 cut(s)	62, 264, 327
HpyF3I	CTNAG	1 cut(s)	86
Hsp92II	CATG	3 cut(s)	80, 113, 443
Ksp22I	TGATCA	1 cut(s)	345
KspAI	GTTAAC	1 cut(s)	235
Kzo9I	GATC	4 cut(s)	145, 178, 319, 345
LpnPI	CCDG	6 cut(s)	91, 150, 264, 291, 369, 433
Lsp1109I	GCAGC	3 cut(s)	46, 56, 276
MaeI	CTAG	5 cut(s)	26, 131, 182, 315, 445
MaeIII	GTNAC	3 cut(s)	21, 28, 68
MalI	GATC	4 cut(s)	147, 180, 321, 347
MboI	GATC	4 cut(s)	145, 178, 319, 345
MfeI	CAATTG	1 cut(s)	11
MflI	RGATCY	1 cut(s)	145
MluCI	AATT	6 cut(s)	11, 254, 284, 331, 388, 425
MmeI	TCCRAC	1 cut(s)	61
MnlI	CCTC	1 cut(s)	9
MseI	TTAA	5 cut(s)	102, 114, 234, 270, 372
MspR9I	CCNGG	1 cut(s)	279
MunI	CAATTG	1 cut(s)	11
Mva1269I	GAATGC	1 cut(s)	96
MvaI	CCWGG	1 cut(s)	279
NdeII	GATC	4 cut(s)	145, 178, 319, 345
NlaIII	CATG	3 cut(s)	80, 113, 443
NmuCI	GTSAC	2 cut(s)	28, 68
NspI	RCATGY	2 cut(s)	80, 113
PciI	ACATGT	1 cut(s)	76
PcsI	WCGNNNNNNNCGW	1 cut(s)	87
PctI	GAATGC	1 cut(s)	96
PfeI	GAWTC	2 cut(s)	7, 196
PkrI	GCNGC	3 cut(s)	46, 61, 266
PscI	ACATGT	1 cut(s)	76
Psp6I	CCWGG	1 cut(s)	277
PspGI	CCWGG	1 cut(s)	277
PspPI	GGNCC	2 cut(s)	134, 359
PsuI	RGATCY	1 cut(s)	145
RsaI	GTAC	1 cut(s)	250
RsaNI	GTAC	1 cut(s)	249
SaqAI	TTAA	5 cut(s)	102, 114, 234, 270, 372
SatI	GCNGC	3 cut(s)	45, 60, 265
Sau3AI	GATC	4 cut(s)	145, 178, 319, 345
Sau96I	GGNCC	2 cut(s)	134, 359
ScrFI	CCNGG	1 cut(s)	279
SetI	ASST	6 cut(s)	49, 136, 215, 269, 316, 355
SinI	GGWCC	2 cut(s)	134, 359
SpeI	ACTAGT	1 cut(s)	25
Sse9I	AATT	6 cut(s)	11, 254, 284, 331, 388, 425
SsiI	CCGC	1 cut(s)	168
SspI	AATATT	1 cut(s)	118
SspMI	CTAG	5 cut(s)	26, 131, 182, 315, 445
StyD4I	CCNGG	1 cut(s)	277
TaaI	ACNGT	4 cut(s)	128, 154, 359, 377
TasI	AATT	6 cut(s)	11, 254, 284, 331, 388, 425
TfiI	GAWTC	2 cut(s)	7, 196
Tru1I	TTAA	5 cut(s)	102, 114, 234, 270, 372
Tru9I	TTAA	5 cut(s)	102, 114, 234, 270, 372
TscAI	CASTG	2 cut(s)	329, 382
TseFI	GTSAC	2 cut(s)	28, 68
TseI	GCWGC	3 cut(s)	44, 59, 264
Tsp45I	GTSAC	2 cut(s)	28, 68
TspDTI	ATGAA	5 cut(s)	20, 146, 188, 212, 295
TspGWI	ACGGA	1 cut(s)	327
TspRI	CASTG	2 cut(s)	329, 382
VpaK11BI	GGWCC	2 cut(s)	134, 359
XapI	RAATTY	1 cut(s)	425
XceI	RCATGY	2 cut(s)	80, 113
XspI	CTAG	5 cut(s)	26, 131, 182, 315, 445

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.